1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Goryan [66]
3 years ago
9

All of earths water, land, and atmosphere within which life exists is known as

Biology
2 answers:
solong [7]3 years ago
8 0
The correct answer is biosphere. 
Sliva [168]3 years ago
7 0
The answer is the Biosphere. 
You might be interested in
Insertion of a device into the muscle to measure the pressure within the muscle is monitoring of __________.
alexdok [17]

Interstitial fluid pressure

7 0
3 years ago
Read 2 more answers
with respect to its surroundings. A particular solute in this cell uses energy for its transport from the cell to its surroundin
Lilit [14]

Facilitated Transport

7 0
3 years ago
The grouping of organisms based on their common descent is called traditional classification. binomial nomenclature. derived cha
Helga [31]
<span>The grouping of organisms based on their common descent is called evolutionary classification. Through evolution, one species has changed and become modified until it became what it is today. However, some of today's organisms have the same predecessor, which is evident if you take evolution into consideration. </span>
4 0
3 years ago
Which of these types of galapagos species most influenced darwin to develop the theory of species change by natural selection?
BartSMP [9]
Given the answers;
a) Reptiles
b) Cactus plants
c) Small birds 
d) Crabs and crayfish
The answer is C. Small birds.
On his visit to the Galapagos Islands, Charles Darwin discovered several species of finches that varied from island to Island, which helped him to develop his theory of natural selection. 

8 0
3 years ago
Vines growing up a wall is an example of _____.
stellarik [79]
<span>Vines growing up a wall is an example of thigmotropism. Hope this helped :)</span>
7 0
3 years ago
Read 2 more answers
Other questions:
  • A group of plants cells was exposed to radiation, which damaged the chloroplasts and caused them to lose function. If the mitoch
    10·1 answer
  • Chicken genetics What do you think that I was feeling a red chicken and white chicken will look like
    14·2 answers
  • Is a mystery liquid and the water outside a solution?
    5·1 answer
  • How is there diversity in all living things?
    12·2 answers
  • Plz help i only have 10 more min on test
    12·2 answers
  • ______ are compounds that produce H+ ions in solution.<br> A. Acids<br> B. Salts<br> C. Bases
    8·2 answers
  • Why are insertion and deletion mutations so harmful?
    13·1 answer
  • Which of these is a mixture? A) air B) water C) hydrogen chloride D) carbon dioxide
    10·2 answers
  • Chose all that apply for spring tides
    15·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!