Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Answer:
can you please show us what the options are and I can for sure help you out?!
Answer:
Photosynthesis makes the glucose that is used in cellular respiration to make ATP. The glucose is then turned back into carbon dioxide, which is used in photosynthesis. ... While photosynthesis requires carbon dioxide and releases oxygen, cellular respiration requires oxygen and releases carbon dioxide.
Explanation:
When an object from a pause state begins to move the potential energy is changed into kinetic energy. One of the example is the yo-yo, it has stored energy due to its position. Once the yo-yo begins its fall the potential energy will change to kinetic energy and vice versa.
