D Streak. The student is scratching it on white paper to test the streak.
Sound waves are slower than electromagnetic waves. Sound waves behave only as a wave, whereby electromagnetic waves act both as a wave and particle, and travel at the speed of light 3.0 x 10^8 m/s d (which is very fast!!!)
During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
Macronutrients are a substance required in relatively large amounts by living organisms, in particular.
a type of food (e.g., fat, protein, carbohydrate) required in large amounts in the human diet.
a chemical element (e.g., potassium, magnesium, calcium) required in large amounts for plant growth and development.
a chemical element or substance required in trace amounts for the normal growth and development of living organisms.
