1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Allushta [10]
3 years ago
13

Helpppppppppp please

Biology
1 answer:
erastova [34]3 years ago
8 0

Answer:

i think its b

Explanation:

You might be interested in
Why are communication signals important in everyday life?
AnnyKZ [126]
Because if their wasn’t any their would be many miss communication and poor communication for many people
8 0
3 years ago
In the model of DNA, the colored pegs represent the four nitrogen bases found in every DNA molecule. One possible correct labeli
Semenov [28]
The answer is D. This is because of the nitrogen compounds that are in it. 
5 0
3 years ago
Read 2 more answers
Where is the abdominal muscle that can only compress the abdomen?
astraxan [27]
<span>Transversus abdominis is the abdominal muscle that can only compress the abdomen</span>
8 0
3 years ago
The diagram below shows a representation of two different waves. Which of the following classifies wave X and
Ivanshal [37]

Answer:A-wave X is transverse and wave Y is longitudinal

Explanation:

4 0
3 years ago
What muscle covers the ventral, abdominal region in rats?
vampirchik [111]

Answer:

the external oblique.

Explanation:

<u>the external oblique</u> covers the ventral, abdominal region in rats.

8 0
2 years ago
Other questions:
  • Complete the sentences describing glycogen breakdown. Some terms will be used more than once, and two terms will not be used at
    11·1 answer
  • Autotrophic organisms require other organisms to produce their own food.<br><br> True ot false.
    6·2 answers
  • On one day the northern polar jet stream follows the path shown on the left (day X). Several weeks later, the polar jet follows
    10·1 answer
  • When dna is _____________, the genes within it tend to be inaccessible and silent; that is, they rarely code for protein?
    7·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Name the plantation dance that started out as an improvisation of stomping and shuffling steps and developed into fancy sliding
    7·1 answer
  • 15)<br> Which is an ADVANTAGE of sexual reproduction?
    7·1 answer
  • Organisms that must get there energy from food or other living things are
    7·1 answer
  • Thrombocytes are essential for coagulation of blood comment
    13·2 answers
  • In a food chain, consumers gather energy by _______. a. consuming organisms at a lower trophic level b. consuming organisms at a
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!