1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
allsm [11]
3 years ago
11

Pls help!! I need the answer immediately

Mathematics
1 answer:
Strike441 [17]3 years ago
4 0

Answer:

i). x³ + 9x² + yz - 15

ii). -21m³np - 8p⁵q + mnp + 4mn + 100

Step-by-step explanation:

Question (38)

i). Two expressions are -5x² - 4yz + 15 and x³+ 4x²- 3yz

  By subtracting expression (1) from expression (2) we can the expression by addition which we can get expression (1).

 (x³+ 4x²- 3yz) - (-5x² - 4yz + 15) = x³ + 4x² - 3yz + 5x² + 4yz - 15

                                                    = x³ + 9x² + yz - 15

ii). -15m³np + 2p⁵q - 6m³pn + mnp + 4mn - 10qp⁵+ 100

  = (-15m³np - 6m³np) + (2p⁵q - 10qp⁵) + mnp + 4mn + 100

  = -21m³np - 8p⁵q + mnp + 4mn + 100

You might be interested in
If f(x) = (x - 1) / (x + 2), then the range of f is given by the interval
Veseljchak [2.6K]

Answer:

B and D

Step-by-step explanation:

Have a great day!

/(OvO)/ *.':☆ *': .✧

3 0
3 years ago
Read 2 more answers
40 POINTS PLZ ANSWER PLZ HELP
Tanya [424]
What picture........................
6 0
2 years ago
Hayley has $155 in savings, and her brother Hank has $230. Hayley is saving $10 each week, and her brother is spending $15 each
Sindrei [870]

Answer:

After 3 weeks they both will have the same amount in their savings account.

Step-by-step explanation:

Given:

Amount saved by Haley = $155

Amount saved by Hank = $230

Amount saving each week by Haley = $10

Amount spending each week by Hank = $15

We need to find Number of weeks when both both will have same amount in savings account.

Solution:

Let Number of week be 'x'.

Total Amount of Haley can be calculated by Amount saved by Haley plus Amount saving each week by Haley multiplied by number of weeks.

framing in equation form we get;

Total Amount of Haley = 155+10x

Also;

Total Amount of Hank can be calculated by Amount saved by Hank minus Amount spending each week by Hank multiplied by number of weeks.

framing in equation form we get;

Total Amount of Hank = 230-15x

Now we need to find the number of weeks when both will have same amount.

To find the same we will have to make both the equation equal.

So we can say.

155+10x=230-15x

On Solving above equation we get;

We will combine the like terms together;

10x+15x =230-155\\\\25x = 75

Now Dividing both side by 25 using Division property of equality we get;

\frac{25x}{25} = \frac{75}{25}\\\\x=3 \ weeks

Hence, After 3 weeks they both will have the same amount in their savings account.

4 0
2 years ago
Answer each question about each polygon.
oksian1 [2.3K]

the answer is a n b

Step-by-step explanation:

5 0
3 years ago
The number of revolutions made by a figure skater for each type of axel jump is given. Determine the measure of the angle genera
trapecia [35]
For radians, multiply the number of jump revolutions by 2 pi 

<span>For degrees, multiply the number of revolutions by 360

Thank you for posting your question here at brainly. I hope the answer will help you. Feel free to ask more questions.
</span>
4 0
3 years ago
Other questions:
  • P, Q, and R are prime numbers such that 3P + 7Q + 15R = 102. What is Q?
    13·1 answer
  • A soup recipe calls for 1 and 1/4 lb of beans the package of beans is label 28 Oz is that enough
    11·1 answer
  • How to solve algebra questions
    7·1 answer
  • HELP MATH 50 POINTS! WILL MARK CORRECT ANSWER BRAINLIEST! 6 QUESTIONS
    13·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Through (-2, -3), perp. to y = x- 2/1
    12·1 answer
  • a sports team has b teams. each team has 7 players. using b, write an expression for the total number of players in the tourname
    7·1 answer
  • Find PNO, please help asap
    6·1 answer
  • Help! i don’t understand pls help
    5·1 answer
  • Simplify the expression (-7 + 2)(8) =​
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!