1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vika [28.1K]
3 years ago
7

What are the strengths and weakness of focus group data method?

Biology
1 answer:
Arada [10]3 years ago
7 0

Answer:

The strengths of a focus group are:

-it gives the moderator more open ideas to work with.

-it has low cost compared to other data methods.

-it speeds up the result collection of the selected topic.

Weaknesses of focus group are:

*It takes effort to assemble the group members.

*Complex data analysis.

*No individual answers.

Explanation:

Focus groups usually involves a number of participants having an open discussion on a specific topic, set by a moderator, usually the person that comes up with the specific topic for focus. The function of a focus group is to collect data through group interactions on a selected topic.

The strengths of a focus group are:

-it gives the moderator more open ideas to work with.

-it has low cost compared to other data methods.

-it speeds up the result collection of the selected topic.

Weaknesses of focus group are:

*It takes effort to assemble the group members.

*Complex data analysis.

*No individual answers.

You might be interested in
What is true of saturated fatty acids?
anzhelika [568]

<u>Answer:</u>  They have the maximum number of hydrogen atoms.

<em>Saturated fatty acids have the maximum number of hydrogen atoms.</em>

<u>Explanation:</u>

A fatty acid that doesn’t contain any double bond between carbons in their molecular structure is known as saturated fatty acid. They are also incapable of absorbing hydrogen in their molecular structure thus the name.

Saturated fatty acids are generally found in animal fats like butter, milk and dairy products. Because of the higher melting point of those fatty acids, they are generally found in solid state at reem temperature.

6 0
3 years ago
If you begin cutting a piece of copper in half and continued cutting it in half until you had the smallest piece you would end u
antoniya [11.8K]

Answer:

B: an atom

Explanation:

An atom is the smallest substance that can exist in isolation.

Hence, if a piece of copper is continually divided, eventually the smallest particle you would get in an atom.

3 0
3 years ago
Which diagram best illustrates how the circulatory system of a fish functions?​
Vilka [71]

Answer:

The bottom one shows how the circulatory system of a fish functions.

8 0
3 years ago
Read 2 more answers
A process that separated the inner planets' composition into different chemical layers is called _____.
dangina [55]

The correct answer is differentiation.

Planetary differentiation can be defined as a process in which separation of different constituents of the planetary body takes place.They are separated based on their physical or chemical behavior, where the body divides into different layers: the less denser materials rise up to the surface and the more denser substance of the planet sinks.

Example: dwarf planets.




6 0
4 years ago
2. Today, scientists propose that Earth is covered with tectonic<br>​
const2013 [10]

Answer:

Plates?

Explanation:

Tectonic Plates are about the only kind of plates I've heard of, besides ones you eat off of. If you are trying to fill in the blank, "plates" should be your best answer.

7 0
3 years ago
Read 2 more answers
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Why is lactic acid moved from the muscles to the liver
    13·1 answer
  • Many different types of mutations can occur within the body. Tay-Sachs disease is a deadly disorder that is caused by a missing
    12·2 answers
  • can someone please help me with this? I'm not asking for all the answers, I just need an explanation and a few ideas. Thanks.
    15·2 answers
  • Hellllpppppppppp!!!! I’m doing a test
    11·2 answers
  • Which of the following is NOT a form of matter?<br> a.) air<br> b.) gold<br> c.) a dog<br> d.) light
    14·2 answers
  • Can someone please answer quick and correctly all three questions btw thxs I will give brainliest
    15·1 answer
  • When the diaphragm contracts, the size of the thoracic cavity ________, the pressure inside the thoracic cavity ________, and ai
    9·1 answer
  • Help plz:
    5·1 answer
  • What does the phrase, “When it pours, the desert stores” refer to?
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!