1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marysya12 [62]
3 years ago
8

Which part(s) of a cell is (are) most like the shipping center of a company? Which part(s) of a cell is (are) most like the ship

ping center of a company? chloroplasts the Golgi apparatus the nucleolus mitochondria.
Biology
1 answer:
Stells [14]3 years ago
6 0

Answer:

the Golgi apparatus

Explanation:

Golgi apparatus also called Golgi body is an organelle found he cytoplasm of most eukaryotic cells, which is responsible for storing maromulecules in membrane-bound vesicles like parcels, such as the proteins produced in the endoplasmic reticulum, and transporting them to their various specific destinations. This organelle helps the cell mainly in intracellular transport.

It can be compared to the shipping center of a company that package parcels with the right address on them, and delivering them to their various destinations where they are needed.

You might be interested in
Science and technology have developed cleaner fuels such as EA-85 fuel. What is a positive impact that this new fuel may have on
nevsk [136]
Fuel with less emissions
5 0
3 years ago
Read 2 more answers
Somebody help me please
inna [77]

Answer:

ppap

Explanation:

4 0
2 years ago
Describe the effects that enzymes can have on substrates​
Bezzdna [24]

Answer:

Enzymes bind with chemical reactants called substrates there may be one or more substrates for each type of enzyme I beleivedepending on the particular chemical reaction. In some reactions, a single-reactant substrate is broken down into multiple products the enzyme's active site binds to the substrate.

Explanation:

Hope this helps.

7 0
2 years ago
Read 2 more answers
A scientist wonders what would happen if all the trees in the Amazon rain forest were cut down. Which of the following is the mo
mariarad [96]

Answer: The natural world should be disturbed as little as possible in an experiment.

Explanation: I just took the quiz

4 0
2 years ago
Two mice breed. The male is heterozygous for the dominant traits of black fur and active behavior but is homozygous recessive fo
olya-2409 [2.1K]

Answer:

Four

Explanation:

Let the allele for black fur be B (the alternate will be b), the allele for active behavior be A (the alternate will be a), and the allele for light eyes be L (the alternate will be l).

<em>Heterozygous dominant for black fur = Bb</em>

<em>Heterozygous dominant for active behavior = Aa</em>

<em>Homozygous recessive for light eyes = ll</em>

Hence, the genotype for a male that is heterozygous for the dominant traits of black fur and active behavior but is homozygous recessive for light eyes will be BbAall.

Bb   Aa   ll

Possible Gametes

<em>BAl, Bal, bAl, and bal</em>

Therefore, the number of different types of gametes produced by the male mouse is four.

5 0
3 years ago
Other questions:
  • Amar is making a cladogram. Out of all the species he is using, he knows that species X and Y are the least primitive and are th
    10·1 answer
  • What is a cold blood horse?
    13·1 answer
  • Which of the following situations is most likely to occur when biodiversity is diminished
    8·1 answer
  • True or false? an aneurysm is the result of a weakened area in an artery.
    10·1 answer
  • What would happen if s-phase did not occur before mitosis?
    12·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Please someone help me and yes it can be more then one answer but give me your best answer
    10·1 answer
  • During photosynthesis, light energy is converted to the energy in chemical bonds. What also happens according to the predictions
    6·2 answers
  • How have plants adapted to different environmental conditions?
    5·1 answer
  • Biology pls help!!!!! Will give brainlest
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!