1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ELEN [110]
3 years ago
11

Franz Boas believed that cultures develop in different ways because of the unique and complex sets of issues and situations that

members of the cultural group face over time. This way of understanding cultural differences came to be known as:________
a) unilineal cultural evolution.
b) structural functionalism
c) the interpretivist approach.
d) historical particularism.
Biology
1 answer:
Lina20 [59]3 years ago
6 0

Answer:

The correct answer is - option D. historical particularism.

Explanation:

Historical particularism is the very commonly accepted case of the school of thought related to the comparative study of the cultures. It has declined other evolutionary model of that time.

According to this model, there is some universal law for the development or cultural evolution. It mean if the societies or cultures are able to develop to the various paths to same level of cultural development.

Thus, the correct answer is - option D. historical particularism.

You might be interested in
Can someone help me and explain please
Aleks [24]
The more air is in the jar, the longer the candle will be able to burn. So the candle in jar 3 probably burned for 4 minutes.
The candle in jar 4 would be able to burn much longer then the others, because it has no lid so air can come through and keep the candle burning.
5 0
3 years ago
The code for heredity is carried on <br><br> in each organism's DNA.
Kryger [21]

Answer:

The code for heredity is carried on genes in each organism's DNA. Explanation; Genes are portions of the genome that codes for a protein or an RNA, Hereditary information that is contained in nucleotide sequence of DNA.

Explanation:

6 0
3 years ago
When water and mercury are placed in glass tubes, the water in the right tube)
Snowcat [4.5K]
No se ha dado el problema que han dicho nada de la gente de la policía y que no han dicho nada de la gente de la cara de de que se ha dado un paso de recoger y que no pueda ver el partido del
5 0
2 years ago
Read 2 more answers
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
The ability to learn, often measured by the ability to grasp complex ideas and solve complex problems
lina2011 [118]

Answer:

Intelligence

Explanation:

Intelligence is basically the ability to learn. It is described as being able to gain knowledge and skills and applying it. So it is not just about knowing things and being able to do things, it also has something to do with being able to "use" knowledge and skills.

With that, the individual is able to understand or like it is mentioned in your question, <u>grasp</u> complex ideas and at the same time, they can use those complex ideas to solve complex problems.

5 0
3 years ago
Other questions:
  • When would green plants carry out photosynthesis only during the day?
    10·1 answer
  • Which process is most likely involved in the change in red blood cell volume?
    5·2 answers
  • This photo shows a plateau. Which events could have caused this plateau to form? Select the three correct answers.
    15·2 answers
  • What is the main difference between a tundra and grassland?
    6·2 answers
  • Which of the following is NOT a function of the skin?
    10·1 answer
  • Confirmation needed<br>[extra characters]​
    7·1 answer
  • What type of plants use a system for transporting water and food?
    8·2 answers
  • Which of the following structures in a plant cell is responsible for the production of food​
    13·1 answer
  • type of advance medical directive does the AMA recommend? a) Euthanasia b) Living will c) Durable power of attorney O d) Undue-b
    15·1 answer
  • What type of atoms will ionic bonds be found between
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!