Thinking if I'm right Eukaryotes are more complex so they are capable of during more things, Prokaryote is smaller than eukaryotic. hope this helps out
Answer:
TTAACGCTAGCGAGCATGGCC
Explanation:
A and T pair together, and G and C are pairs. Whenever you see one of them in the original sequence, you'd just write the other one for the complementary sequence.
Answer: lipids are nonpolar
Explanation:
because water is polar and lipid is non polar, so it is insoluble in water that is it floats water
(1) Effects of large families on child development. (2) The educational problems. (3) lags in the new technology. (4) Increased inequities in agriculture. (5) Unemployment and underemployment.
Answer:
What best describes the relationship between the two sets of reactions of photosynthesis, which are the light-dependent reactions and the light-independent reactions? Only the light-independent reactions produce sugars, but they depend on products of the light-dependent reactions.
Explanation:
What best describes the relationship between the two sets of reactions of photosynthesis, which are the light-dependent reactions and the light-independent reactions? Only the light-independent reactions produce sugars, but they depend on products of the light-dependent reactions.