1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lisabon 2012 [21]
4 years ago
11

After the centromeres separate during mitosis, the chromatids move toward opposite poles of the spindle and after cytokinesis be

come _____________.
a. centrosomes

b. kinetochores

c. half spindles

d. daughter chromatids

e. daughter chromosomes

The microtubules of the mitotic spindle attach to a specialized structure in the centromere region of each chromosome called the:
a. kinetochore.

b. nucleosome.

c. equatorial plate.

d. nucleotide.

e. centrosome.

A cell entering mitosis with 48 chromosomes will produce two cells, each with:
a. 24 chromosomes.

b. 48 chromosomes.

c. 12 pairs of chromosomes.

d. 36 pairs of chromosomes.

e. 6 pairs of chromosomes.

When the centromeres divide and chromosomes begin to migrate, the mitotic stage is called:

a. Interphase.

b. Telophase.

c. Metaphase.

d. Anaphase.

e. Profase.

Which of the following is true of daughter cells of meiosis I, but not true of daughter cells of mitosis?
a. Chromosomes have previously migrated to opposite poles.

b. DNA from the original cell has been equally divided.

c. Homologous chromosomes have been separated.

d. The cytoplasm of the original cell has divided.

e. All of the above are true of both processes.

Which of the above does NOT normally happen to homologs during meiosis?
Some gene exchange occurs.
Eventually, the homologs end up in different cells.
The separation of one pair of homologs is independent.
The genes controlling some functions will be absent from some gametes.
There will be no purely paternal and maternal chromosomes in the gametes formed.
After cytoplasmic division the result of meiosis II is:
a. Two diploid cells

b. Four diploid cells

c. Two haploid cells

d. Four haploid cells

e. Four diploid cells and four haploid cells

Regulation of the cell cycle is dependent upon cyclins and cyclin-dependent kinases. The key(s) that allows a cell to progress beyond the restriction point is (are)
a. cdk1 and cyclin B.

b. cyclin D and p21.

c. cyclin A and Cdk2.

d. phosphorylation of RB by Cdk4 and Cdk2

e. external signals from growth factors.

New gene combinations are created during the process of
mitosis.
spermatogenesis.
fertilization.
asexual reproduction.
both b and c are correct.
A human cell containing 22 autosomes and one Y chromosome is a
a. somatic cell of a male b. zygote c. somatic cell of a female

d. a sperm e. an ovum
Biology
1 answer:
Bond [772]4 years ago
3 0
Hello there.

<span>Regulation of the cell cycle is dependent upon cyclins and cyclin-dependent kinases. The key(s) that allows a cell to progress beyond the restriction point is (are)

</span><span>c. cyclin A and Cdk2.
</span>
You might be interested in
What affects do you expect the structural differences between prokaryotes and eukaryotes do to function
Andrej [43]

Thinking if I'm right Eukaryotes are more complex so they are capable of during more things, Prokaryote is smaller than eukaryotic. hope this helps out

4 0
3 years ago
Write the complementary sequence to following DNA strand: AATTGCGATCGCTCGTACCGG
k0ka [10]

Answer:

TTAACGCTAGCGAGCATGGCC

Explanation:

A and T pair together, and G and C are pairs. Whenever you see one of them in the original sequence, you'd just write the other one for the complementary sequence.

7 0
4 years ago
What prevents lipids from mixing in water
anastassius [24]

Answer: lipids are nonpolar

Explanation:

because water is polar and lipid is non polar, so it is insoluble in water that is it floats water

5 0
3 years ago
Read 2 more answers
Implications of growing population?​
uysha [10]
(1) Effects of large families on child development. (2) The educational problems. (3) lags in the new technology. (4) Increased inequities in agriculture. (5) Unemployment and underemployment.
6 0
3 years ago
Which best describes the relationship between the two sets of reactants of photosynthesis,which are the light-dependent reaction
Paladinen [302]

Answer:

What best describes the relationship between the two sets of reactions of photosynthesis, which are the light-dependent reactions and the light-independent reactions? Only the light-independent reactions produce sugars, but they depend on products of the light-dependent reactions.

Explanation:

What best describes the relationship between the two sets of reactions of photosynthesis, which are the light-dependent reactions and the light-independent reactions? Only the light-independent reactions produce sugars, but they depend on products of the light-dependent reactions.

4 0
3 years ago
Read 2 more answers
Other questions:
  • Think about the variety of biomes on Earth and differences in their weather patterns. Which statement describes a difference bet
    6·2 answers
  • The structure which eats breathes and excretes wastes for the developing baby throughout gestation
    11·1 answer
  • What tectonic feature is associated with a complex or uncertain plate boundary?
    6·2 answers
  • i need help with everything can someone help me i think i did the conversion wrong and i’m not tryna fail but i was absent and i
    13·1 answer
  • Quiz Read the verse.
    10·1 answer
  • What are three items you use on a daily basis that have come from research in earth science
    9·2 answers
  • The mutation below is best described as a
    5·1 answer
  • Suppose that a certain enzyme is synthesized whenever the solution in which the cells aregrowing contains substance Y. When subs
    11·1 answer
  • What is biological magnification?
    12·1 answer
  • 10. If the red allele is incompletely dominant to the white alle<br> individual's phenotype be?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!