1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arte-miy333 [17]
3 years ago
6

The last caribbean monk seal that died was the last memeber of what

Biology
1 answer:
mars1129 [50]3 years ago
7 0

Texas coast in 1926 and 1932. The last seal recorded to be killed by humans was killed on the Pedro Cays in 1939.

You might be interested in
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
Ethology is the study of animal _____.
Rzqust [24]
<span>Ethology is a branch of zoology concerned with the study of animal behavior. Ethologists take a comparative approach, studying behaviors ranging from kinship, cooperation, and parental investment, to conflict, sexual selection, and aggression across a variety of species.</span>
5 0
3 years ago
Read 2 more answers
How to get big and all thing
victus00 [196]

Answer:

hih

Explanation:

what that means what ur talking bout

5 0
3 years ago
What a culture considers acceptable strongly influences the expression of anger. Which culture-bound syndrome is a dissociative
tekilochka [14]

Answer:

Amok.

Explanation:

Amok may be defined as a type of the culture bound syndrome and may occur due to the feeling of jealousy by an individual. Amok can be brought by the humiliation and desperation feeling.

The main characteristics of amok is aggression, brooding period outburst by violent and homicidal behavior towards people and object. The individual can do murder as well.

Thus, the answer is amok.

5 0
3 years ago
How do cells know how to differentiate?
jonny [76]
Cells know how to differentiate through a process called gene expression. It’s a specific combination of genes that are turned on and off.
8 0
3 years ago
Other questions:
  • Identify the points that lactic acid fermentation and alcoholic fermentation have in common.
    13·1 answer
  • Vascular plants that have seeds surrounded by fruit are called_______
    8·1 answer
  • How can you tell the difference between carbohydrates and lipids?
    7·1 answer
  • Classification of living things takes into consideration all of the following except
    12·1 answer
  • Describe how a measurement can be accurate but not precise?
    12·1 answer
  • Which figurative language technique is used in the sentence: "I couldn't have lived without giving you a present."
    6·1 answer
  • Dark skin (a result of increased melanin production in equatorial peoples) is likely a response to ultraviolet radiation, becaus
    6·1 answer
  • What are immortal cell lines and why are they important for cell research? (APEX diversity in science ws)
    8·1 answer
  • How does compaction lead to lithification
    13·1 answer
  • Please answer thiis lol?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!