1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mr Goodwill [35]
4 years ago
11

Which characteristic property allows multicellular algae, like red, green, and brown algae, to make the maximum use of sunlight?

Biology
1 answer:
Sergeu [11.5K]4 years ago
5 0
Red, green, and brown algae have accessory photosynthetic plastids containing different pigments than the chloroplasts.
<span>It is known that chlorophyll absorbs red light and reflects green. That's why plants containing chlorophyll are green. </span>At a depth of the sea where these algae live, there is no red light but different. Red, green, and brown algae have other pigments that can absorb that different light and which allow these algae to maximum use sunlight.
You might be interested in
Moving ridges of water on the surface of the ocean caused by wind and constantly cause weathering along the shoreline. *
FromTheMoon [43]

Answer:

Waves

Explanation:

Waves are moving bodies of water that crash against the shore and cause erosion.

5 0
3 years ago
DNA is made of two chains of nucleotides. Which type of bonds hold the chains together?
Lena [83]

Answer:

O hydrogen bonds

ionic bonds

Explanation:

5 0
3 years ago
What is a pathogen?
Inga [223]

Answer:

B. A microorganism that causes diseases.

Explanation:

Pathogen is a microorganism that causes diseases.

<h3>I hope it helps ❣❣❣</h3>
5 0
3 years ago
Organs that work together form a tissue. t or f
mamaluj [8]
Your answer is FALSE, tissues that work together form an organ. Organs that work together form a organ system

hope this helps

8 0
3 years ago
Read 2 more answers
Kari is testing the hypothesis that plants rely on photosynthesis to grow. She conducts an experiment in which she observes the
Galina-37 [17]
A, C, D are all examples of qualitative data because qualitative data is what can be seen/ touched/ observed and quantitive data is what can be recorded. hope this helps :)
5 0
4 years ago
Read 2 more answers
Other questions:
  • Which of the following is an example of a diploid cell? A gamete, an egg, two sperm cells or a somatic cell
    14·1 answer
  • Which of the following is true about plants and cellular energy?
    7·2 answers
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • What protein looks looks like a cork screw?
    8·1 answer
  • Why is it important that the correct DNA strand be used as the template strand?
    11·1 answer
  • Question 5
    9·1 answer
  • 1. Where are the Galapagos Islands located? (5 points)
    8·2 answers
  • Question 2 How will the plants that grow from this plant's fertilized seeds compare to the plants grown from its daughter tubers
    11·1 answer
  • Cattle ranchers and dairy farmers rarely allow all of their animals to reproduce. Instead, they practice artificial selection an
    15·1 answer
  • Explain the process of cellular respiration?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!