1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elena L [17]
3 years ago
9

Angina pectoris is the accumulation of plaque on the inner walls of arteries.

Biology
1 answer:
Diano4ka-milaya [45]3 years ago
5 0

Answer:

b. False  

Explanation:

Angina pectoris is the medical term for chest pain that results from coronary heart disease.

It occurs when the heart muscle doesn't get as much blood as it needs and is usually caused by the accumulation of plaque on the inner walls of the heart’s arteries.

You might be interested in
What are some of the Non-market, Environmental values of trees?
Mkey [24]
The evernimoentol mark of chris is the first of the
3 0
3 years ago
What do tissues working together form?
jeyben [28]
They form an organ

Have a nice day
3 0
3 years ago
Name the red pigment inside red blood cells that help to carry oxygen.
Ksju [112]

Answer:

Hemoglobin.pulmonary artery.

Explanation:

1. about hemoglobin.Hemoglobin is the protein inside red blood cells. It carries oxygen.

2. about pulmonary artery.The pulmonary artery is a big artery that comes from the heart. It splits into two main branches, and brings blood from the heart to the lungs. At the lungs, the blood picks up oxygen and drops off carbon dioxide. The blood then returns to the heart through the pulmonary veins.

3. There exist a concentration difference of carbon dioxide and oxygen inside the alveoli and capillaries due to which the diffusion of the two gases takes place. The carbon dioxide moves from the blood to the alveoli sac and the oxygen moves from the sacs to the blood.

3 0
11 months ago
A metal body of mass 81 g occupies a volume of 30 cm3. Identify the metal.
Cerrena [4.2K]

Answer:

Aluminum

Explanation:

The density of Aluminum is 2.7 g/cm3

We know the volume and mass of the unknown metal, as density is mass/volume:  81g/30cm3 = 2.7 g/cm3 which is the density of Aluminum :)

8 0
3 years ago
Read 2 more answers
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Other questions:
  • Using the images or terms, describe how parts of a cell interact to export proteins.
    10·1 answer
  • Describe two advantages of genetic engineering. (4 points)
    9·2 answers
  • You are studying a new species never before studied. It lives in acidic pools in volcanic craters where temperatures reach 100°c
    8·1 answer
  • What if dessert plants were removed from the desert
    6·2 answers
  • Which statement is true? O A. A hypothesis must be based on the researcher's analysis of the data collected in the experiment. O
    6·1 answer
  • Can someone please help im so confused asap
    7·1 answer
  • Which of the following could be a function of a phagocyte?
    8·1 answer
  • Any body wants to talk im bored what is DNA
    15·2 answers
  • In cats grey color (G) is dominant to white color (g). If a white female has kittens with a heterozygous male, and the mother is
    15·1 answer
  • The type of cartilage that forms the long bones of the embryonic skeleton is:.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!