1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kamila [148]
3 years ago
5

Consider this expression: 7(10a+3b)

Mathematics
2 answers:
Andreyy893 years ago
4 0
The answer could be 70a+21b
belka [17]3 years ago
4 0

Answer: 70a + 21b

Step-by-step explanation:

By The Distributive Property, we can multiply a sum by multiplying each addend separately and then add the products,

That is, a(b+c) = ab + ac,

Here, the given expression is,

7 (10a + 3b),

By the above property,

We can write,

7 (10a + 3b) = 7 × 10a + 7 × 3b = 70a + 21b

Where, 70a and 21b are two different terms,

Thus, the required expression is 70a + 21b.

You might be interested in
Me ayudan con esa ecuacion por sustitucion con la comprobacion pliss
attashe74 [19]
<span>1/2x+3y/4=5 => (1/2)x + (3/4)y = 5

1/5x+3y/2=2  => (1/5)x + (3/2)y = 2

Eliminate the fractional coefficients:  Mult. the first equation by 4 and mult. the second equation by 10:


2x + 15y = 20     

</span><span>Multiply the 1st equation by -1:

-</span>2x - 3y = -20
2x + 15y = 20 
-------------------
       12y = 0, so y = 0.  Then the first equation becomes  2x + 3(0) = 20, or
                                     x=10.

Solution is (10,0).
8 0
3 years ago
Identify a solution to this system of equations -4x+3y=23, x-y=-7
Komok [63]

bearing in mind that a solution to a system of equations is where their graph intersect or meets, Check the picture below.

6 0
4 years ago
Find an equivalent mixed number for the decimal number.<br><br> 16.3
timofeeve [1]

Answer:

16 3/10

Step-by-step explanation:

Think about what fraction become .3 when put into a calculator

that's a 3 in the tenths place in the decimal system so the fraction would be 3/10. Then finally add on the 16

*an aside if this is wrong it it is possible that they have rounded 1/3 to one decimal place. (1/3 is usually .33333 repeating)

6 0
3 years ago
Read 2 more answers
Fashion for all jeans on sale for $13 designer pants has jeans on sale for $26 write tye total costs of 1,2,3 and 4 pairs of jea
kramer

Answer:

To purchase 4 pairs of jeans at Fashion for all would cost you $52, while buying 4 pairs of jeans from designer pants would cost $104.

Step-by-step explanation:

Fashion for all jeans:

1=13

2=26

3=39

4=52

Designer jeans

1=26

2=52

3=78

4=104

5 0
3 years ago
Solve this problem please :)
zvonat [6]
The Answer is B 8/3 :)
4 0
3 years ago
Other questions:
  • What is the volume of the pyramid? A.420cm^3 B.139cm^3 C.484cm^3 D.142cm^3
    13·2 answers
  • Can anyone help me with a problem on my math assignment. I need to find the surface area
    7·1 answer
  • F(x)=4x+1 and g(x)=x^2-5find(f-g)(x)
    9·1 answer
  • Annie earns $7.50 per hour working after school. She needs at least $185 for a stereo system. Write an inequality that describes
    12·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Tam multiplied 2.13 and 4.62, as shown. But he forgot to put a decimal point in his
    5·2 answers
  • The scatter plot below shows the relationship between two variables, x and y. Which line best fits the data? У 30 25 20 15 10 5
    9·1 answer
  • Milly wrote the equation 6= -2x-6<br><br> What is the value of x ?
    12·1 answer
  • a linear function contains the following points. what are the slope and y-intercept of this function?
    14·1 answer
  • Write the system of equations, then solve. SHOW ALL WORK!! please HELP! QUICK
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!