1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
PSYCHO15rus [73]
2 years ago
9

Maria formed which of the following?

Biology
2 answers:
kherson [118]2 years ago
6 0

A ... Basaltic Lava seems like the best answer based on what I found on the lunar maria.

slava [35]2 years ago
5 0

Maria formed Basaltic Lava.

You might be interested in
What is the 2nd phase of cellular respiration? what happens?
liubo4ka [24]

The second phage of cellular respiration is transition stage.

Process take place in transition stage:

The transition stage take place in mitochondria. The pyruvate is combined with NAD+ to form NADH and acetyl co-enzyme molecules.

After transition stage, Krebs cycle starts.

5 0
3 years ago
Help me please omggggg ahhhhhh
Svet_ta [14]

Answer:

Letter C would be the best possible answer choice.

Without food, the deer will starve and die, unable to reproduce new deer. The wolves will eat the dead dear but run out of deer since there are none to reproduce more.

Explanation:

- 英辞郎 <3

6 0
2 years ago
Read 2 more answers
What is a partially enclosed body of water formed where a river flows in an ocean?
Vinvika [58]
Estuary, is a partially enclosed body of water formed where a river flows in an ocean.
3 0
3 years ago
Name the quadrant(s) (RUQ, LUQ, RLQ, and LLQ) and region(s) (right hypochondriac, epigastric, left hypochondriac, right lumbar,
andreev551 [17]

Answer:Answer: 1) (a) The left lobe of the Liver is located in Left Upper Quadrant while the main part of the Liver is located in the Right Upper Quadrant.

(b) The liver is located in both the right hypochondriac region and the epigastric region

2) (a) The stomach is is located in the Left Upper Quadrant (LUQ)

(b) The stomach is majorly located in the epigastric region and the Left Hypochondriac Region.

3) (a)The Spleen is located at the Left Upper Quadrant (LUQ)

(b) The regions the Spleen are located at are the Left Hypochondriac Region, Epigastric Region and Left Lumbar

4) (a) The Gall Bladder is located at the Right Upper Quadrant

(b) The Gall Bladder is located at the Right Hypochondriac Region and the Right Lumbar Region.

5) (a)The Appendix is located in the Right Lower Quadrant

(b) The Appendix is located in the Right Iliac region.

6) (a) The Left kidney is located at the Left Upper Quadrant

(b) The left kidney cuts across the Left Hypochondriac Region, Right Lumbar and the Left Lumbar.

7) (a) The right Ovary is located at the Right Lower Quadrant

(b) The region of the right ovary is the hypogastric region.

8) (a) The Uterus is located at both the Right Lower Quadrant and Left Lower Quadrant.

(b) The Uterus is located in the hypogastric region of the abdomen.

Explanation: In medicine, the practitioners divide the lower part of the body known as the 'abdomen' with imaginary lines ( one vertical and one horizontal) to form the 'Quadrants' and (two vertical and two horizontal) the 'Regions'. The Quadrants are divided into four main parts:

1) Left Upper Quadrant (LUQ)

2) Right Upper Quadrant (RUQ)

3) Left Lower Quadrant (LLQ)

4) Right Lower Quadrant (RLQ)

The regions are divided into nine parts:

1) Left Hypochondriac Region

2) Right Hypochondriac Region

3) Epigastric Region

4) Left Lumbar Region

5) Right Lumbar Region

6) Umbilical Region

7) Right Iliac/Inguinal Region

8) Left Iliac/Inguinal Region

9) Hypogastric Region.

The abdomen is divided into regions in order to help medical practitioners and students easily understand the abdominal area of the body as well as the human anatomy. It also helps them provide preliminary diagnosis and treatment based on pain emanating from each region or quadrant.

6 0
3 years ago
What is another wavelength that we cant see
Fudgin [204]

Answer:

ultraviolet wavelengths

Explanation:

3 0
3 years ago
Other questions:
  • After chewing a piece of bread for awhile, you begin to experience a slightly sweet taste. this taste results from _____.
    5·1 answer
  • Which compounds represent the reactant(s) in the chemical equation below?
    5·1 answer
  • Antinomycin A is a poison that affects the electron transport chain and renders it nonfunctional. In the presence of Antinomycin
    8·1 answer
  • Pls answer real quick!!
    10·1 answer
  • Helpp please ASAP!! I will mark Brainliest!!
    11·2 answers
  • Evolution definition
    13·2 answers
  • What is Genetic “Gene” Therapy?
    15·2 answers
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • Suggest TWO different ways by which the deficiency disease caused by a lack
    5·1 answer
  • What statement best compares photosynthesis and cellular respiration?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!