All categories

3 years ago

Why do innie belly buttons pop out during pregnancy, but not weight gain?

1 answer:

4 0

Because while you're preagant your have so much presure on it it doesnt have a choice where as weight gain everything grows with it. Think of it this way, if you've ever felt a pregants womans belly its harder than usual. If you touch someones belly that is bigger its more smoshy (I know thats not spelt right)

You might be interested in

List three changes of state during which energy is absorbed.

mote1985 [20]

The three changes of state during which energy is absorbed are:

1. Change from solid to liquid - Melting.

2. Change from liquid to gas - Vaporization

3. Change from solid to gas - Sublimation

All these changes of state require heat energy to break the attractive forces that hold the particles of the molecules together, so that they can move into more disorderly states. For instance, when heat is applied to a solid, the solid absorbs the heat and use it to break the attractive forces that are holding the molecules of the solid together. At a particular temperature, the attractive forces will be completely overcome and the solid framework will collapse, thus leading to the melting of the solid.

7 0

3 years ago

Read 2 more answers

How does an increased population size affect the amount of competition between organisms?

zmey [24]

Competition will increased because more organisms will be competing for resources

5 0

3 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago

In the past, the parathyroid glands were sometimes mistakenly removed during surgery when another part of the body was removed.

lukranit [14]

Answer:

Thyroid gland

Explanation:

Parathyroid glands are the endocrine glands and are four in number. One superior and one inferior parathyroid glands are attached to each lateral lobe of the thyroid gland. These glands are found embedded in the tissues of the lateral lobes of the thyroid gland. During the removal of thyroid glands in patients, parathyroid glands may be mistakenly removed.

3 0

3 years ago

Could somebody please help me?

guajiro [1.7K]

Answer:

Explanation:

5 0

3 years ago