All categories

4 years ago

All of the following statements help to explain why water molecules form hydrogen bonds except:________

Chemistry

1 answer:

Natalka [10]4 years ago

8 0

Answer:- Water is an electronegative molecule.

Explanation:

A molecule cannot be electronegative. Rather the atoms in a molecule may be electronegative. This first statement does not account for the hydrogen bonding in water at all because it is incorrect. However, the other statements in the question sheds more light on the nature of hydrogen bonding in water molecule.

You might be interested in

Osmotic pressure ____.a. occurs only in ionic solutions.b. is lower with 1 M NaCl than 1 M sucrose.c. is created using detergent

Firdavs [7]

Answer:

d. is the hydrostatic pressure produced on the surface of a semi-permeable membrane by osmosis.

Explanation:

Osmosis -

It is the flow of the molecules of solvent from a region of higher concentration towards the region of lower concentration via a semipermeable membrane , is known as osmosis.

Osmotic pressure -

It refers to the minimum amount of pressure , which is required to be applied to the solution in order to avoid the flow of pure solvent via the semipermeable membrane , is referred to as osmotic pressure.

Or in simple terms ,

Osmotic pressure is the pressure applied to resists the process of osmosis.

Hence ,

From the given options in the question,

The correct option regarding osmotic pressure is d.

6 0

3 years ago

Near the equator, the sun heats the surface strongly, causing warm air to rise steadily. This creates the _________________, an

kenny6666 [7]

Doldrums, low is the correct answer.

8 0

3 years ago

A sample of gallium Bromide GaBr2,weighing 0.165 g was dissolved in water and treated with silver nitrate AgNO3, and resulting t

tresset_1 [31]

<u>Answer:</u> The percent gallium in gallium bromide is 30.30 %.

<u>Explanation:</u>

To calculate the number of moles, we use the equation:

$\text{Number of moles}=\frac{\text{Given mass}}{\text{Molar mass}}$ .....(1)

Given mass of gallium bromide = 0.165 g

Molar mass of titanium gallium bromide = 229.53 g/mol

Putting values in equation 1, we get:

$\text{Moles of gallium bromide}=\frac{0.165g}{229.53g/mol}=0.00072mol$

The chemical equation for the reaction of gallium bromide and silver nitrate follows:

$GaBr_2+2AgNO_3\rightarrow 2AgBr(s)+Ga(NO_3)_2$

By Stoichiometry of the reaction:

1 moles of gallium bromide produces 1 mole of gallium nitrate

So, 0.00072 moles of gallium bromide will produce = $\frac{1}{1}\times 0.00072=0.00072moles$ of gallium nitrate

Now, calculating the mass of gallium nitrate from equation 1, we get:

Molar mass of gallium nitrate = 193.73 g/mol

Moles of gallium nitrate = 0.00072 moles

Putting values in equation 1, we get:

$0.00072mol=\frac{\text{Mass of gallium nitrate}}{193.73g/mol}\\\\\text{Mass of gallium nitrate}=0.139g$

Calculating the mass of gallium in the reaction, we use unitary method:

In 1 mole of gallium nitrate, 1 mole of gallium atom is present.

In 193.73 grams of gallium nitrate, 69.72 g of gallium atom is present.

So, in 0.139 grams of gallium nitrate, the mass of gallium present will be = $\frac{69.72}{193.73}\times 0.139=g$

To calculate the percentage composition of gallium in gallium bromide, we use the equation:

$\%\text{ composition of gallium}=\frac{\text{Mass of gallium}}{\text{Mass of gallium bromide}}\times 100$

Mass of gallium bromide = 0.165 g

Mass of gallium = 0.050 g

Putting values in above equation, we get:

$\%\text{ composition of gallium}=\frac{0.050g}{0.165g}\times 100=30.30\%$

Hence, the percent gallium in gallium bromide is 30.30 %.

3 0

3 years ago

DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message

Katarina [22]

CGGAUUACGGGCUCAUUGUGGCCA

7 0

3 years ago

Please help! (20POINTS)

rewona [7]

Answer: 6. FALSE. The factory uses mechanical energy and when carbon is released into the atmosphere it is the process of chemical energy.

7. TRUE. Solar energy is created when it is used in the process of photosynthesis in a plant. Then chemical energy is used when the plants create glucose.

I hope this help you out

5 0

3 years ago