1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sauron [17]
3 years ago
7

What are root hairs responsible for?

Biology
1 answer:
astraxan [27]3 years ago
4 0
To collect the water and mineral nutrients.
You might be interested in
The area of a shoreline that is alternately exposed and submerged is the?
STALIN [3.7K]
Intertidal zone-Referred sometimes as foreshore,which is area above water at low tide and under water at high tide
8 0
3 years ago
Read 2 more answers
Anyone know the answer....
Ivenika [448]

I an positive it is D.

3 0
3 years ago
Pose a question about simple and complex organisms
Sunny_sXe [5.5K]
Can a complex organism interbreed with a simple organism?
6 0
3 years ago
Read 2 more answers
we can block light by placing obstacles in its path, but it’s much more difficult to block sound. why?
krek1111 [17]
It's harder to block sound because sound waves and transverse waves, causing the sound to bounce off objects. This isn't the same with light.
8 0
3 years ago
How many lactobacillyus present in 1 lire of curd packet
murzikaleks [220]

A genus of gram-positive, microaerophilic, rod-shaped bacteria occurring widely in nature. Its species are also part of the many normal flora of the mouth, intestinal tract, and vagina of many mammals, including humans. Pathogenicity from this genus is rare.

hope it helps

5 0
3 years ago
Other questions:
  • All of the following are functi?
    7·2 answers
  • When condensation rates decrease, causing fewer clouds to form, how might humans change their behavior
    13·1 answer
  • Which of the following is not a common use for public land?
    12·2 answers
  • Multiple Allele So far we have studied traits or genes that are coded for by just two alleles. Like in rabbits, there was one al
    12·1 answer
  • How do plants reproduce? <br><br> 1. Sexually<br> 2. Asexually
    8·1 answer
  • Monosaccharides are also known as what?
    10·2 answers
  • Muchos medicamentos son productos
    9·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • infected mosquitoes landed on socks three times more often than uninfected mosquitoes. Explain how this information can be used
    15·1 answer
  • Las característica de los bioelementos
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!