1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksandrvk [35]
3 years ago
8

I need help with this questions pls. Thank you

Biology
2 answers:
irina [24]3 years ago
7 0

Answer:

i'm pretty sure its D

Explanation:

DNA is a polymer. The monomer units of DNA are nucleotides, and the polymer is known as a "polynucleotide." Each nucleotide consists of a 5-carbon sugar (deoxyribose), a nitrogen containing base attached to the sugar, and a phosphate group.

uysha [10]3 years ago
6 0
I believe it’s B. DNA is a polymer made of nucleotide monomers
You might be interested in
A cruise ship makes his way from when Island to another this ship is emotion compare with which preference point
Finger [1]

The correct answer to this open question is the following.

Although you forgot to attach the options for this question we can say the following.

A cruise ship makes its way from one island to another. the ship is in motion compared with which reference point?

The correct answer is "a lighthouse on a nearby island."

In this case, that is the function of the lighthouse. To be the point of reference or the guiding element that the captain of the ship is going to use to keep the ship's trajectory correct.

Although there are uncontrollable external elements such as heavy storms, fog, or bad weather, the captain of the ship is going to be guided by the lighthouse.

7 0
3 years ago
Is a group of similar cells that act a functional unit
maksim [4K]
Tissues is the most basic organismal level, <span>which are groups of similar cells that act as a functional unit. </span>
4 0
4 years ago
Look at the diagram showing the different wavelengths in sunlight.
wel

Answer:

It’s d...

Explanation:

I said this a while ago but they keep deleting my answer?!? For what, my answer is literally correct.

4 0
3 years ago
Read 2 more answers
2. a) In what way is the genetic code in all organisms the same? (1 point)
White raven [17]

Answer:

the genetic code is universal.

Explanation:

3 0
3 years ago
Glucose is a form of sugar found in the blood. Cells use glucose as a source of energy, but too much or too little can cause ser
Marizza181 [45]
Insulin levels would increase.
The insulin stimulates the liver to convert excess glucose to glycogen for storage.
7 0
3 years ago
Read 2 more answers
Other questions:
  • A membrane that allows only some materials to move in and out of the cell is _____.
    9·1 answer
  • Drag each item to the correct location in order to place the events in the development of plants into the correct order​
    8·1 answer
  • What are the complementary base pairs in dna?
    11·1 answer
  • re viruses alive? The scientific debate continues. Viruses exhibit some characteristics of life, but others are missing. The MOS
    11·1 answer
  • What is the difference between sensory, motor and relay neurons?​
    7·1 answer
  • 7. Why do scientists think that photosynthetic prokaryotes were probably not the first life forms on Earth?
    8·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Motor units that involve Type II fibers are typically activated via...
    9·1 answer
  • During the Human Genome Project, scientists learned that most of the human genomes
    8·2 answers
  • Which of the following is an example of the endocrine system directly interacting with the nervous system?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!