1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ahrayia [7]
3 years ago
8

What is the best definition of a eukaryotic cell open study?

Biology
1 answer:
oksano4ka [1.4K]3 years ago
5 0
Having cells with good or membrane bound nuclei
You might be interested in
Why might fish exist before amphibians?
Daniel [21]

Answer:

Because fish are their own species.

6 0
3 years ago
Which mutation is harmful to the organism? A. a mutation allowing moths to camouflage better on blackened tree bark B. a mutatio
expeople1 [14]

The correct answer is D. Mutation causing uncontrolled cell division.

Mutation is termed as the alteration of sequence of nucleotides which is permanent to organisms or extrachromosomal DNA or virus.

During DNA replication mutation may result from different errors. For example, during meiosis we can say that the result of mutation can be harmful if mutation can change proteins which are being produced by a gene.

4 0
4 years ago
Read 2 more answers
What of the following is not a reason algae are classified as plant
lawyer [7]

They are single celled organisms

3 0
4 years ago
Read 2 more answers
Aproximately 30% of substitution mutations result in no change in the genetic code, why?
Zepler [3.9K]

Answer:

1. A mutation that causes changes in the amino acid sequence downstream of the mutation is called FRAME SHIFT MUTATION. The correct option is D. A frame shift mutation is one in which the mutation is caused either by the addition or deletion of base pairs in the DNA of a gene, this results in the translation of the genetic code in the wrong reading frame starting from the position of the mutation to the end of the affected gene. Frame shift mutation result in the production of nucleotide that are not divisible by three. Because the nucleotide codons are usually pair in three, frame shift mutation causes a change in the reading frame and this result in a protein translation that is different from the original.

2. The correct option is D.

If the third base A is deleted from the codon given in the question, it will results in the formation of frame shift mutation and this will change the translation of the protein from leucine to tyrosine. The deletion will not affect the first amino acid in the sequence.

3. Albinism is a type of mutation that can is described as DELETERIOUS. The correct option is D.

Deleterious mutation refers to any type of mutation which reduces the fitness of a living organism. Albinism is a medical condition in which an individual experience a partial or total loss of skin pigmentation. The condition is a genetic disorder that is caused by lack of adequate amount of melanin pigment in the skin. Albinism causes vision loss, extreme sun sensitivity and stigma.

4. The type of mutation that occur is INSERTION. The correct option is B. Insertion is a type of mutation in which one or more nucleotide base pairs are added to a DNA sequence. The inserted base pairs can be small or large. Examples of disease conditions that resulted from insertion mutation are Huntington's disease and fragile X syndrome.

5 0
3 years ago
THIS IS PLANT SCIENCE BTW !!! A source of healthy, locally grown food for the population of a given area :
Dvinal [7]
This is a very confusing question since it sounds more like a statement. sorry really wish I could help :(
8 0
3 years ago
Other questions:
  • Describe the steps involved in converting sunlight into the energy that is stored in food and compare the processes of cellular
    8·1 answer
  • There are many traits for which it seems natural selection should favor an increase every generation, such as survival from birt
    14·1 answer
  • Is a tank full of gasoline potential or kinetic?
    10·1 answer
  • Which hummingbird adaptation is most advantageous for supporting their high metabolism?
    14·2 answers
  • After teaching the parent of an infant who has had a surgical repair for a cleft lip about the use of elbow restraints at home,
    14·1 answer
  • Identify five places where carbon may be found
    7·1 answer
  • Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
    5·1 answer
  • Consequences of air pollution?
    12·1 answer
  • I look in the mirror but i'm not there and instead i see a strange disoriented ghost like figure. Whats wrong with me. Is this a
    11·2 answers
  • What is the key adaption of angiosperms that allowed these plants to dominate the landscape?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!