1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jok3333 [9.3K]
4 years ago
11

All eukaryotic cells have membrane covered compartments called

Biology
1 answer:
Tcecarenko [31]4 years ago
6 0
All eukaryotic cells have membrane covered compartment called organelles. They include the nucleus, the Golgi, mitochondria, endoplasmic reticulum and many others. So the answer is- organelles. ;)
You might be interested in
A liter is the same as a cubic meter. True False
BaLLatris [955]
1 L is equal to 0.001 m³ there for the answer is (False)
7 0
3 years ago
What kind of a simple machine is an ax blade?
sweet [91]
The axe is an example of a simple machine, as it is a type of wedge<span>, or dual inclined plane. </span>
4 0
3 years ago
Members of this arthropod group have three body parts...
son4ous [18]
<span>Crustaceans
these are the members that have 3 body parts!!!!
please mark brainliest</span>
4 0
3 years ago
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
2. Two heterozygous Oompah’s are crossed. What is the probability that the offspring will have orange faces?
Ulleksa [173]
9:3:3:1 is the correct ratio. 
4 0
3 years ago
Other questions:
  • It is believed that the coelacanths and lungfish (lobed fin fishes) represent a crucial link between other fishes and tetrapods.
    15·1 answer
  • What do animal cells have that plant cells don't? give a detailed answer if you can?
    6·1 answer
  • What is the relationship between the food we eat and energy in the body
    10·2 answers
  • Following a cut or scrape what process repairs your skin?
    9·2 answers
  • A student hypothesized that pillar coral digest zooxanthellae for energy. Which prediction is based on the student's hypothesis?
    15·2 answers
  • The beaker in the illustration below contains two solutions of salt with different concentrations (measured by molarity, M). The
    15·1 answer
  • The process where maiten magma rises and sinks due to tempature of difference, CRIVNCONEO
    7·1 answer
  • What is the most common type of desalination plant in the world?
    6·1 answer
  • Which is the best example of a response to an external stimulus?
    15·2 answers
  • What terms means that molecules are evenly or equally distributed on both sides of a cell membrane?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!