1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KiRa [710]
3 years ago
6

This diagram shows the count of different species of snakes in a sample taken from an ecosystem.each shape represents a unique s

pecies
Biology
1 answer:
murzikaleks [220]3 years ago
8 0

Answer: A

Explanation:

You might be interested in
Why is it important for ecologists to be aware of forest destruction?
Lyrx [107]
Just incase they need to evacuate the area
6 0
3 years ago
Read 2 more answers
When conditions in the environment change, a lack of genetic diversity may be disadvantageous for organisms that reproduce _____
Kamila [148]

Answer:

  • When conditions in the environment change, a lack of genetic diversity may be disadvantageous for organisms that <u>reproduce asexually</u> . Genetic diversity may be advantageous for organisms that reproduce when conditions in an environment change.    

Explanation:

  • Each organism is required to have a specific set of factors that are required to produce more healthy offspring, as for the asexual reproduction to be carry out by the certain organisms there is a priority of having a more diverse form of environment for the organisms to carry out there reproduction or else it will derail there whole rate of producing healthy offspring.
3 0
3 years ago
Really need help please help me !
posledela

Answer:

Explanation:

i cya help yuh dere nuh

8 0
3 years ago
3 Which waters contain the most nutrients and plankton for fish to feed on?
defon
3. Is b
4. Is d
5. Is a
4 0
3 years ago
Read 2 more answers
If there is dissolved carbon dioxide in the water, are underwater plants able to perform photosynthesis? Explain why or why not.
Alenkasestr [34]

Answer:

Plants undergo photosynthesis, which is the process where carbon dioxide, water, and sunlight are transformed into sugar and oxygen. Even though they look different than terrestrial (land) plants, aquatic plants, or plants that live on the water's surface or submerged underwater, also undergo photosynthesis.

6 0
3 years ago
Other questions:
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Which of these is a hypothesis?
    12·1 answer
  • Lennox is a department chair at a local university. He always gives department faculty members a chance to express their opinion
    8·2 answers
  • What type of attraction occurs when water molecules attract other types of molecules?
    12·1 answer
  • Which theory best explains the present arrangement of continents oceans and landforms on earth
    12·2 answers
  • Which of the following is not a primary difference between mitosis and meiosis?
    8·2 answers
  • Amal was on a picnic to Hatta with his parents and family friends. While playing, he collected some muddy water from the Wadi in
    7·1 answer
  • Aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
    7·1 answer
  • 1. The maximum population that an ecosystem can support indefinitely is called the
    13·1 answer
  • 1. As a group, you and three other students must make a presentation on an animal. Which option is the best example of your grou
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!