1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zhenek [66]
3 years ago
14

I need help with numbers 3, 4, and 5. 20 POINTS

Biology
1 answer:
Dimas [21]3 years ago
5 0
A chemical reaction bonding monomers together to make a polymer
You might be interested in
Agricultural lands frequently require nutrient augmentation because
fenix001 [56]

The given is incomplete as the options are missing. The correct options for the given question are as follows-

(A) cultivation of agricultural land inhibits the decomposition of organic matter

(B) nitrogen-fixing bacteria are not as plentiful in agricultural soils because of the use of pesticides

(C) land that is available for agriculture tends to be nutrient-poor

(D) the nutrients that become the biomass of plants are not cycled back to the soil on lands where they are harvested

Answer:

Option (D)

Explanation:

In order to carry out agricultural practices, the soil must be rich in essential nutrients for the growth of crops. The soil fertility is a key role in the production of crops.

This agricultural land often requires a large amount of these nutrients and minerals because some of the nutrient minerals are converted into plant biomass which is then used up to produce energy in other sectors. So, the nutrients that were present in the soil are taken away and not transferred back into the soil. This means that the nutrient cycle gets affected. Due to this reason, there requires a constant supply of nutrients into the agricultural fields.

Thus, the correct answer is option (D).

8 0
3 years ago
Questions are in the picture answer both plsss
vovangra [49]

Answer:

13. is Option J) all of the above

and 14 I'm not completely sure but I think its option D.

7 0
3 years ago
URGENT! I need help please!!
Gelneren [198K]

Hey ur answer should be A and C

4 0
3 years ago
What must first form before plants can colonize new land?
serious [3.7K]

Answer:soil

Explanation:

6 0
3 years ago
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
Other questions:
  • Leonard designed a parallel circuit to light two lightbulbs. But his circuit doesn’t work. Which two items in the circuit must b
    12·1 answer
  • Which of these describes the most common way that material is added to a continental shelf?
    5·1 answer
  • Translation occurs on the surface of which organelle?
    7·1 answer
  • A star begins with a mass 8 to 20 times that of the Sun's mass will do what
    14·1 answer
  • Three muscles in the human body that have the same name
    9·1 answer
  • Deforestation occurs when large areas of trees are cut down. Which of the following impacts on the environment would result from
    14·2 answers
  • Which numbers identify the organelles that are present in BOTH plant and animal cells? A) 1, 2, 3, 4, 5 B) 1, 4, 5 C) 1, 5 D) 1,
    7·2 answers
  • You might find _____ in the Arctic.
    13·2 answers
  • When the land or oceans are heated unevenly,
    5·2 answers
  • Would you revise this food web to make it more accurate is yes explain how
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!