1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sattari [20]
3 years ago
10

What would happen if you fed termites a drug that killed trichonympha?

Biology
2 answers:
yaroslaw [1]3 years ago
7 0
<h2>Answer:</h2>

Termite will not perform its function which is digesting cellulose. Hence termite will unable to decay woods.

<h3>Explanation:</h3>

Termites and trichonympha ( a protist ) are in symbiotic relation. Trichonympha lives in the hind gut of a termite. Termites give a home to trichonympha while trichonympha produce an enzyme which is used by termites to digest cellulose. So without trichonympha, there will be no enzyme and no digesting activity by termites.

kolbaska11 [484]3 years ago
3 0

Answer: they won't be able to digest there food the way they use to

Explanation:

You might be interested in
Humans are part of complex ecosystems. Describe a few components of the ecosystem in which you live. In your answer: - identify
DerKrebs [107]
Abiotic factors in common ecosystems:

1: Bats are interesting creatures, and use echolocation to make food
2: The cave walls help spread the voices of the bats
3: They have to use echolocation to breathe

Biotic factors:

1: Some good roles for bats are predators 
2: They effect the system of computers when they bite computer chips
3: They complex human system life<span />
8 0
3 years ago
What is the desired product of cellular respiration
son4ous [18]

Answer:

C. Carbon dioxide

Explanation:

That is the desired product

7 0
2 years ago
Read 2 more answers
How much of a person's weight is water?
Tresset [83]
Well, on average 2/3 of a persons weight is water.
8 0
3 years ago
Read 2 more answers
How many groups are in the modem periodic table
sweet [91]

Answer:

The correct answer is

18

Groups of the periodic table: The s-, p-, and d-block elements of the periodic table are arranged into 18 numbered columns, or groups.

Hope this helps!

- Quinn <3

7 0
3 years ago
Which is a gamete? A.Progesterone B.Testis C.Sperm D.Steroid
Sedbober [7]
C. Sperm is the answer
7 0
3 years ago
Read 2 more answers
Other questions:
  • Invasive species always have negative impacts to the ecosystem in which they are introduced. Question 15 options: True False
    14·1 answer
  • A disaccharide combines with water to produce two monosaccharides in the process known as?
    10·2 answers
  • Which of the following is an example of a chemical change
    14·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • The Ring of Fire is a string of volcanic sites in the Pacific Ocean that stretches between the Americas, Asia, and Australia. Wh
    11·1 answer
  • Most people in Central Asia live in
    9·1 answer
  • Which of the following is a specialist species?
    8·2 answers
  • A bird catches and tries to eat a caterpillar. The caterpillar has a bad taste, so the bird lets the caterpillar go. The next ti
    9·2 answers
  • Does anyone know this one please help me stuck on it
    5·2 answers
  • In order for a trait to be considered a competitive advantage, the trait must(1 point)
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!