1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Debora [2.8K]
2 years ago
7

An ionic bond is formed when _____. See Concept 2.3 (Page 37) An ionic bond is formed when _____. See Concept 2.3 (Page 37) both

atoms are equally attractive to electrons one atom transfers an electron to another atom both atoms are electrically neutral atoms are subjected to radioactive isotopes both atoms are nonpolar
Biology
1 answer:
Rufina [12.5K]2 years ago
5 0

Answer: The ionic bond is when one atom transfers an electron to another atom

Explanation:

Ionic bond is formed between oppositely charged substances - a positively charged substance, and a negatively charged substance.

Usually, an atom donates its electron (become positively charged) to another atom to complete its outermost shell (becoming negatively charged).

Thus, the formation of transfer of electrons creates an IONIC BOND

You might be interested in
Why is variations beneficial to the species but not necessary to individuals ​
Nimfa-mama [501]
Variations are beneficial for the survival of the species. Populations of organisms fill well-defined places, or niches, in the ecosystem, using their ability to reproduce.However, if some variations were to be present in a few individuals in these populations, there would be some chance for them to survive.
8 0
3 years ago
Read 2 more answers
What is the period of the cell cycle during which activities such as cell growth and protein synthesis occur without visible sig
Zepler [3.9K]
Its interphase i think : 
The meaning of Interphase is : the period of the cell cycle during which the nucleus is not undergoingdivision, typically occurring between mitotic or meiotic <span>divisions.</span>
6 0
3 years ago
Read 2 more answers
All of the following are ways in which ecosystems change naturally?
gogolik [260]
Deforestation is not a natural change.
3 0
2 years ago
Read 2 more answers
How do u think earths internal process cause surface features on earths as large as Mount Everest
IRINA_888 [86]
That's a very good question!! That would have to go along with the process of weathering and erosion. Basically how the heat, weather, and he pressure of the Earth forms land . Mount Everest was formed when India plate moved rapidly northwards towards Euro Asia plate.
Hope this helps!!
7 0
2 years ago
Energy from the sun causes water to evaporate from the land and from bodies of water. As this water vapor moves high into the ai
V125BC [204]
C clouds

Clouds form when the invisible water vapor in the air condenses into visible water droplets or ice crystals
5 0
2 years ago
Other questions:
  • "what is the most difficult step in reconciling a checking account"
    7·2 answers
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Pyrolobus fumarii, an extreme thermophile, can survive at a temperature as high as 113 C. This microorganism could be categorize
    13·1 answer
  • Exercises including jumping, skipping, and calisthenics (such as those used in a warm-up) are called _______________ exercises.
    5·1 answer
  • Compare the excretory system and urinary system.
    8·1 answer
  • Which organism does not have a double loop circulatory system A) bird B)fish C) human D) dog
    6·1 answer
  • What are the functions of nerve cells
    15·1 answer
  • Microorganisms and humus have little impact on soil health. true or false
    5·2 answers
  • Does caffeine increase the heart rate of an earthworm
    11·1 answer
  • I A segment of a DNA molecule unzips, revealing a instructions in a for that protein. with the​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!