1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tanya [424]
3 years ago
15

Better mirrors the mitosis process. Meiosis II Meiosis I

Biology
2 answers:
harina [27]3 years ago
8 0

Answer:

Meiosis 1 better mirrors the process of mitosis.

Explanation:

During the process of mitosis, the somatic cells of the body replicate to form two daughter cells which are identical to the parent cell. In meiosis I, two daughter cells are formed. During mitosis, diploid cells are formed. During meiosis 1 also, two diploid cells are formed. hence, these two processes are more similar as compared to mitosis II. in mitosis II, four haploid cells are made as a result of the division process.

REY [17]3 years ago
5 0

Answer: meiosis I

Explanation:

You might be interested in
Katherine wants to investigate if the time of day a plant is watered affects the growth of the plant. She waters diferent plant
olga_2 [115]
B
it need to be 20 long ignore this
5 0
2 years ago
The type of reproduction where the parent organism makes a copy of its DNA, doubles in size and then splits into 2 individual, b
Llana [10]

Answer:

a sexual

Explanation:

a sexual reproduction

8 0
3 years ago
A positive feedback loop causes a self amplifying cycle in which a physiological change leads to even greater change in the same
iVinArrow [24]

The given statement is TRUE.

A positive feedback loop causes a self amplifying cycle in which a physiological change leads to even greater change in the same direction.

A negative feedback loop is a process in which the body senses a change, and activates mechanisms to reverse that change.

What is a positive feedback loop?

In nature, a positive feedback loop happens when the outcome of a reaction increases that reaction. A positive feedback loop pushes a system further away from the equilibrium goal if we consider a system in homeostasis. It takes place when something needs to happen quickly and does this by enhancing the effects of a product or event.

<u>Example</u> : Ripening of fruit

In nature, there is a strange phenomenon when a tree or bush may suddenly and silently begin to ripen all of its fruit or veggies. This is the first instance of a beneficial biological feedback loop we've found. If we see an apple tree with many apples, they all appear to ripen over night, going from being unripe to ripe to overripe. The first apple to ripen will mark the start of this. It releases ethylene (C2H4) via its skin when it is ripe. The apples nearby ripen as a result of being exposed to this gas. As soon as they are ripe, they too begin to generate ethylene, which continues to ripen the rest of the tree in a manner akin to a wave.

To know more about positive feedback loop click on the link below:

brainly.com/question/19911791

#SPJ4

8 0
1 year ago
Explain how concentration gradients across membranes are maintained
puteri [66]

Answer:  

The idea of concentrations and gradients within them is important when understanding the movement of substances across cell membranes. The more particles there are in a certain volume, the more concentrated those particles are. A solution with a low solute concentration has a high water concentration, and a high water potential.

8 0
3 years ago
Regions of dna that read the same forward as backward are called ______ and include the testis-specific genes on the y chromosom
deff fn [24]
<span>Regions of DNA that read the same regardless of the direction are called Palindromes. The sequence of nucleotides is the same whether you start from the 3' end or the 5' end. Palindromes may occur due to chromosomal inversion or due to breakage.</span>
5 0
3 years ago
Other questions:
  • The body of mrs. morgan's vertebra is fractured. what type of bone tissue makes up the majority of the vertebral body? describe
    8·1 answer
  • Activated CD8 cells will mount a direct attack on target cells through the action of ____________ , which punch holes in membran
    5·1 answer
  • For many women around the world, life is a seemingly unending process of childbirth, child-rearing, and hard domestic labor, whi
    14·2 answers
  • Gastric secretions digest ?​
    8·1 answer
  • How does the structure of DNA influence its function?
    11·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Lock and key hypothesis and induced fit hypothesis​
    11·1 answer
  • What have been some contributing factors that have led to increasing temperatures on earth?
    9·2 answers
  • Oxygen is exchanged between lungs and tissues using the heart to pump it round the body in the blood.
    14·2 answers
  • Select the correct answer.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!