Answer: asked the patient two questions about feelings of hopelessness and feelings related to the enjoyment of activities
Explanation:
Hopelessness is an emotional context featured by a lack of hope, passion, and optism. It is expressed as a symptom of varying behavioral and mental health problems, including depression, bipolar, anxiety, eating disorders and among others.
In the other hand, the test on feelings related to enjoyment was done to evaluate the the emotions of pleasure from the individual’s engagements.
However, the physician carried out the two tests on his patient to know whether he's depressed or not.
Answer: For decreased chances of rejection
Explanation:
The three higly polymorphic MHC 1 genes in human beings are HLA-A, HLA-B and HLA-C.
These determine the compatibility of the organ or tissue in the recipient's body each by the help of many alleles that segregates in a population.
There are very less chances that a random chosen donor will match the a recipient six allele genotype.
This is the reason parent may be the best donor for organ transplantation or tissue transplantation.
Answer:
The correct answer is option a.
Explanation:
Osteoporosis refers to a condition that weakens the bone, and enhances the threat of unanticipated and sudden fractures, also known as porous bones. It leads to an enhanced loss of bone mass and strength. The disease often advances without any kind of pain or signs.
There is a direct association between the reduction of estrogen post menopause and the emergence of osteoporosis. Postmenopause, the breakdown or resorption of bone takes over the formation of novel bone. Estrogen diminishes the function and number of osteoclasts. Thus, the reduction in the levels of estrogen after menopause leads to bone loss.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Given what we know, we can confirm that the tree with the fungi will be more likely to survive.
<h3>Why would this tree survive over the other one?</h3>
This has to do with the benefit from the symbiotic relationship established with the fungi. In exchange for nutrients to live, the fungi offer the tree protection from pathogens such as the one it is being injected with.
Therefore, we can confirm that the tree with the fungi will be more likely to survive.
To learn more about symbiotic relationships visit:
brainly.com/question/26741757?referrer=searchResults
