1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leona [35]
3 years ago
5

What type of animals do you like and if you could be one which one will it be and why​

Biology
2 answers:
IRISSAK [1]3 years ago
7 0

<em>ACTUALLY, I LIKE ALL ANIMALS AND CREATURES ON EARTH.</em>

<em>THEREFORE</em><em>,</em><em> </em><em>I</em><em> </em><em>WANT</em><em> </em><em>TO</em><em> </em><em>OPEN</em><em> </em><em>A</em><em> </em><em>PLACE</em><em> </em><em>WHERE</em><em> </em><em>I</em><em> </em><em>WILL</em><em> </em><em>GIVE</em><em> </em><em>SHELTERS</em><em> </em><em>AND</em><em> </em><em>FOODS</em><em> </em><em>AND</em><em> </em><em>SO</em><em> </em><em>ON</em><em> </em><em>TO</em><em> </em><em>THEM</em><em>.</em>

<em>AS</em><em> </em><em>A</em><em> </em><em>FOREST</em><em> </em><em>,</em><em> </em><em>WILD</em><em> </em><em>LIFE</em><em> </em><em>CENTURY</em><em>.</em>

<em>$</em><em>#</em><em>$</em><em> </em><em>THANK</em><em> </em><em>YOU</em><em> </em><em> $</em><em>#</em><em>$</em>

Shalnov [3]3 years ago
5 0
I like forest animals mostly and i would wanna be a wolf because they have few predators
You might be interested in
What is the relationship between cellular respiration ETC and oxygen
Evgesh-ka [11]

The relationship between the two is that ETC allows cytochrome to pass into it's final acceptor oxygen.

3 0
3 years ago
What is off the coast of cascadia under the water​
Diano4ka-milaya [45]

The Cascadia Subduction Zone I believe, it's a dipping fault that seperates Juan de Fuca and North America.

3 0
3 years ago
What would happen to the original rabbit population if you introduced another type of rabbit, one that could run faster and esca
Sonbull [250]

Answer: the new population would die off first

Explanation:

4 0
3 years ago
Read 2 more answers
Which statement correctly describes genetic diseases or disorders? If one inherits a gene for a specific disease, and the gene i
Dmitrij [34]
I would say A just because if your dad has a genetic disease and you mom does not have it you have about a 50 50 chance of having that disease in a perfect control that's assuming that its recessive and that your moms side does not present this disease   
that's how its always been taught to me

8 0
3 years ago
Read 2 more answers
How are hypothesis tested ?
blondinia [14]
Hi,

Hypothesis is tested by doing an experiment and COLLECTING DATA.

Hope this helps.
r3t40
5 0
3 years ago
Read 2 more answers
Other questions:
  • What is responsible for setting up the differences between the tropical, temperature, and polar zones?
    10·2 answers
  • Within the cell energy is released at the
    13·1 answer
  • During interphase, the DNA in the nucleus of the cell is thin and threadlike and called _____.
    15·2 answers
  • According to the U.S. Census Bureau, Philadelphia had a population density of 11,379.5 people per square mile in 2010, while the
    11·1 answer
  • Which o the following is true about cellular resporation
    15·1 answer
  • A disturbance that transfers energy from place to place is called aa.wave.b.medium.c.vibration.d.compression. please select the
    15·1 answer
  • Suppose a species of tulip has three alleles for the gene that codes for flower color. The <img src="https://tex.z-dn.net/?f=C%5
    15·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • In Smileys, eye shape can be starred (SS), circular (CC), or a circle with a star (CS).
    10·2 answers
  • Which two body systems work together to release and move hormones throughout the body
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!