1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ira [324]
3 years ago
5

How and why might actual soils differ from the idealized six-horizon soil profile

Biology
1 answer:
madam [21]3 years ago
5 0

The idealized six-horizon soil profile is not a good representation of all soils because there are big variations, mainly because of the climate factors.

Explanation:

When a soil profile is presented, it is often the one that pretty much everyone knows, the six-horizon profile. This is not a good representation of all soils though, or rather for most of the soils, as the situation in reality is much different. This six-horizon profile is actually idealized, or rather as to how a soil profile should look like.

Lot of the soil types across the world don't have six horizons, or their depths are much different than in the idealized profile. The main reason for this is the climate, as it is the basic factor that later influences all the other ones that influence the formation of soil. We can take the desert soil and polygonal soil as examples:

  • The desert soil is very poor in nutrients. The O horizon is either few mm or non-existent. It contains salts.
  • The polygonal soil is also very poor in nutrients, with the O horizon also being just few mm. This soil lacks rock base, as well as depth, as it is often only few cm deep.

Learn more about soil profile and soil horizon brainly.com/question/6995384

#learnwithBrainly

You might be interested in
An increase in the amount of which atmospheric gas is thought to cause global climate warming?
Salsk061 [2.6K]

Answer:

Carbon Dioxide

Explanation:

4 0
3 years ago
Could some one plz help me quick!
ioda

Answer:

1.) A factory produces chemical waste and releases it into a water system

2.) Water becomes polluted in nearby rivers and streams

3.) Aquatic plants stop thriving

4.) Small fish do not have adequate food

5. Larger fish have less prey to eat and their numbers decline

6 0
2 years ago
Read 2 more answers
_________ allows competitors to coexist.
ladessa [460]

Answer: Resource partitioning

Explanation:

In order to make organisms of different species (competitors) coexist, limited resources are to be divided with a ecological area.

Organisms of same species could be made to live together, so as to reduce wastage of limited resources

6 0
3 years ago
Which isotope is best for dating metamorphic rocks?
KatRina [158]
Uranium-235 is the answer
5 0
3 years ago
The amygdala is thought to control defensive behavior via outputs from the _____ nucleus of the _____.
Anika [276]

The amygdala is thought to control defensive behavior via outputs from the central nucleus of the amygdala

What does the Amygdala do?

It is crucial in processing and regulating emotional reactions. Especially important in strong emotional reactions such as fear and anger

What does the amygdala control?

The amygdala is commonly thought to form the core of a neural system for processing fearful and threatening stimuli , including detection of threat and activation of appropriate fear-related behaviors in response to threatening or dangerous stimuli.

Central nucleus of Amygdala :

The central nucleus of the amygdala (CeA) has been traditionally viewed in fear conditioning to serve as an output neural center that transfers conditioned information formed in the basolateral amygdala to brain structures that generate emotional responses.

What does the central nucleus consist?

The central nucleus of the amygdala (CeA) is primarily composed of GABAergic interneurons which are finely controlled through glutamatergic neurotransmission and signaling. The CeA can be divided into the medial (CeM) and lateral (CeL) divisions

Learn more about Amygdala :

brainly.com/question/24171355

#SPJ4

5 0
1 year ago
Other questions:
  • Bases have ____________ H+ concentrations and ____________ OH- concentrations.
    5·1 answer
  • In a changing environment, which organisms have an advantage—those that reproduce asexually or those that reproduce sexually? Ex
    6·1 answer
  • In a(n) _____ like the kidney, several kinds of tissues work together.
    7·2 answers
  • Please help me with all of question number 7
    8·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Which part of a plant protects and ensures the survival of fertilized eggs
    10·2 answers
  • Disruption of which organelle, would cause the most change in the function of<br> the cell?
    9·1 answer
  • What is peristalsis and where does it occur?
    13·2 answers
  • Carbohydrates are polyhydroxy compounds of A. Glucose B. Oligosaccharides C. Aldehyde and ketone D. Glyceraldehyde​
    5·1 answer
  • What is meant by Productive theory.​
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!