Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
That is the second planet Venus
Answer:
Science includes the process of coordinating patterns of evidence with current theory
Explanation:
Genetics combines Dna, technology, and agriculture
One of the main differences between butter and canola oil is that are room temperature one is a solid and the other is a liquid. This change in phase is due to the bonding between carbon bonds, the more double bonds that there are present the higher the melting point and the fluidity changes. Based on this the correct answer is C=C is found in canola oil while more C-C bonds are found in butter, making option 2 (C=C) the correct answer. In addition option 3 (C=H) can be ignored since hydrogen can only make single bonds. hope this helps:)
