1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
wel
3 years ago
12

How is a model of an atom different from a real atom?

Biology
1 answer:
HACTEHA [7]3 years ago
4 0

it would be (D) because you cant see an atom without a microscope and a model is a larger model of the actual thing. 
You might be interested in
Which of these is not true of enzymes?
postnew [5]
The incorrect one is b. different enzymes has a different optimum temperature.
5 0
3 years ago
Mariana’s teacher has asked her to determine the type of a sample of blood. After doing some tests, she has learned that the red
Anika [276]
Your answer would be Type O blood, which is a universal donor.
7 0
3 years ago
Read 2 more answers
Jillian has a condition called agenesis of the uterus a woman with this condition is born without a uterus what type of infertil
Furkat [3]

Answer:

in vitro fertilization

4 0
4 years ago
Read 2 more answers
What were the major contributions of the H.M.S. Challenger to the study of oceanography? How did its expedition contribute to fu
inn [45]

Answer:

The H.M.S. Challenger embarked from Portsmouth, England on December 21, 1872 and changed the course of scientific history. Physicists, chemists, and biologists collaborated with expert navigators to map the sea. This interdisciplinary spirit has continued to the present day. During the 4 year journey, the voyages circumnavigated the globe, sounded the ocean bottom to a depth of 26,850 feet, found many new species, and provided collections for scores of biologists.

C. Wyville Thomson led the expedition but died of exhaustion from the journey, which ended on May 24, 1876. The Challenger had zig-zagged around the globe and had visited every continent, including Antarctica.

The reports of the Challenger expedition were supervised by Sir John Murray, whose biological conclusions were of great importance to the later development of marine biology. He concluded, for example, that the deep-sea fauna was not "ancient," in that it did not resemble the faunas found in ancient fossil deposits.

Explanation:

8 0
3 years ago
Read 2 more answers
Anyone from the USA here??
Elina [12.6K]

Answer:

me

Explanation:

4 0
2 years ago
Read 2 more answers
Other questions:
  • Which of the following best describes the result of meiosis II? (2 points)
    6·2 answers
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • URGENT PLEASE ANSWER 
    10·1 answer
  • Please help what's the answer <br> What's a good find and know
    12·2 answers
  • Each homoglobin molecule contains?
    14·1 answer
  • The specific combination of alleles an organism has is called its ____ which affect(s) the organism's ____.
    5·1 answer
  • How are food webs different to food chains? Explain why foodwebs are more useful
    14·1 answer
  • Which type of mutation often has the least effect on organisms' traits (and may have no effect at all)? Nondisjunction Substitut
    5·1 answer
  • One living plant leaf, still attached to the plant, is placed into a cup and covered with water. A light source is placed above
    13·2 answers
  • The table below shows the characteristics of four pathogens.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!