1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lbvjy [14]
4 years ago
8

_____ resemble small bacteria, but like viruses they can only multiply by invading the cells of another life form.

Biology
2 answers:
Fittoniya [83]4 years ago
6 0

Answer:

Rickettsia

Explanation:

Rickettsia are usually considered as a separate group of bacteria. These microorganisms which multiply by binary fission inside their host cells are a group of obligately intracellular gram-negative mircoorganisms, having cell walls that look exactly as that of a typical bacteria cell wall. They possess no flagella. They are carried as parasites such as lice and tcks, and also cause diseases such as typhus.

TiliK225 [7]4 years ago
4 0

Answer:

**Rickettsiae** resemble small bacteria, but like viruses they can only multiply by invading the cells of another life form.

Explanation:

Rickettsiae are obligate intracellular organisms resembling gram negative bacteria because they stain slightly pink on gram stain.

Like viruses they can only multiply by invading the cells of another life form because they are obligate intracellular and cannot form their own ATP alongwith NADH and Co-Ach. As these are the necessary components for an organism / cell to grow and replicate , they use he machinery of another living organism , spread through bloodstream and survive and replicate in the cells of organism.

Thus they resemble bacteria and viruses but actually they are parasites.

You might be interested in
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
Which of the following is not a potential concern associated with the use of biotechnology?
Alik [6]
<span>The option which is not a potential concern associated with the use of biotechnology is the production yields of GM foods, whereas the other options are quite dangerous when you think about them. Genetic ownership means that somebody could steal your genes and use them for cloning, which is another option here. Trainsgenic foods also have to be kept safe, so as to stop someone from messing with them. The production yields of GM foods is not the problem, the problem is whether that food is healthy or not.</span>
4 0
4 years ago
Why is water split during the light reactions?
Svetlanka [38]

During Light reactions of Photosynthesis, the chlorophyll will be activated by light. This light activated chlorophyll will split the water molecule. This is called Photolysis. Water molecule is split to release H+ ions and also oxygen.

7 0
3 years ago
Which of the following items is NOT found on the periodic table?
soldier1979 [14.2K]

Answer:

b

Explanation:

4 0
3 years ago
The goal of a scientist is to attempt to understand the natural world without ______
steposvetlana [31]
B. Being Biased as scientists want concrete facts that haven't been influenced by bias or outside forces.
5 0
3 years ago
Other questions:
  • Semi-conservative replication of DNA refers to
    7·1 answer
  • Geysers, hot springs, and bubbling mud are landscape features that are produced by which source of energy?
    6·2 answers
  • In tomatoes, round fruit (R) is dominant over long fruit (r), and smooth skin (S) is dominant over fuzzy skin (s). A true-breedi
    13·1 answer
  • What is the main function of the structure that is identified as A in the picture above?
    15·1 answer
  • Which of these is an example of an abiotic factor
    6·1 answer
  • The explosive force of a volcanic eruption depends on the type of magma in the magma chamber. The type of magma depends on its _
    12·2 answers
  • The neurotransmitter acetylcholine
    5·1 answer
  • Most serious plant - pathogen belongs to ?
    13·1 answer
  • Explain lithosohere in your own words?​
    11·1 answer
  • Which statement best describes the germ theory of disease?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!