1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zloy xaker [14]
3 years ago
8

A catalyst -

Chemistry
2 answers:
cupoosta [38]3 years ago
3 0
A catalyst increases the reactions rate
vlabodo [156]3 years ago
3 0
The naswer is d because when a catalyst reacts with a product it increases the tempeture for the reaction to occur faster
You might be interested in
What is the mass of snow (in tons) on a 150.0ft by 45.0 ft flat roof after a 6.0 inch snowfall? Assume that 11 inches of snow is
Aneli [31]
6 inches of snowfall would be equivalent to 6/11 inches of water or 6/132 feet. So the volume of the equivalent amount of water on the roof is 150 ft. x 45 ft. x 6/132ft. = 306.8 cubic feet.   
Since there are 907185 grams in a ton and 28316.8 mL in a cubic foot, 1.00 g/mL is equivalent to 0.0312 tons/cubic foot  
Multiplying the two results gives 9.58 tons of snow.
5 0
3 years ago
Pablo's experiments confirm the relationship between pressure and the number of gas molecules. as the pressure in a system incre
horrorfan [7]
The correct answer is:  [C]:  
___________________________________________________________
          "<span>pressure and the number of gas molecules are directly related."
___________________________________________________________
<u>Note</u>:  The conclusion was: "</span> as the pressure in a system increases, the number of gas molecules increases" — over the course of many trials.
          This means that the "pressure" and the "number of gas molecules" are directly related.

Furthermore, this conclusion is consistent with the "ideal gas law" equation:

     " PV = nRT " ; 
____________________________________________________________
in which:

    "P = Pressure" ; 
    "n = number of gas molecules" ; 
___________________________________________________________
        All other factors held equal, when "n" (the "number of gas molecules") 
 increases in value (on the "right-hand side" of the equation), the value for "P" (the "pressure" — on the "left-hand side" of the equation), increases.
___________________________________________________________
6 0
3 years ago
Read 2 more answers
What elements were formed in Nuclear fusion?
Sonja [21]

Answer:

tritium and deuterium are combined and result in the formation of helium

6 0
3 years ago
DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte
uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA:  5'-  CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0
3 years ago
The source of the sun's heat is A. nuclear fission. B. nuclear fusion. C. nuclear disintegration. D. nuclear separation
ExtremeBDS [4]

✧・゚: *✧・゚:*    *:・゚✧*:・゚✧

                  Hello!

✧・゚: *✧・゚:*    *:・゚✧*:・゚✧

❖ The source of the sun's heat is B. nuclear fusion

~ ʜᴏᴘᴇ ᴛʜɪꜱ ʜᴇʟᴘꜱ! :) ♡

~ ᴄʟᴏᴜᴛᴀɴꜱᴡᴇʀꜱ

5 0
2 years ago
Read 2 more answers
Other questions:
  • The activation energy for the reaction no2(g)+co(g)⟶no(g)+co2(g) is ea = 375 kj/mol and the change in enthalpy for the reaction
    8·1 answer
  • A sample of air with a volume of 2.20m3 at a pressure of 105 KPa and a temperature of 30c is cooled to 10c and the pressure is r
    10·2 answers
  • How are Jupiter and Saturn similar?
    6·2 answers
  • How many valence electrons does the neutral Mg atom have?
    15·2 answers
  • Please use the E/Z notation when specifying stereochemistry remembering to use parentheses and a dash. Reminder - the double bon
    5·1 answer
  • Please help, once again. Can't seem to get this...
    9·1 answer
  • 10 examples of<br>combination reaction​
    11·2 answers
  • Collision of which two types of plates create the deepest earthquakes? Why do you think this is?
    10·1 answer
  • 2 = 15 what would the expression 2 + 15 be equal to
    13·1 answer
  • Two scientists are debating how to classify a new animal species that they have discovered. They observe that the animal is capa
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!