1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
True [87]
2 years ago
5

Describe how H. Habilis might have lived

Biology
1 answer:
adell [148]2 years ago
5 0
Probably like cave men since they had stone tools 
You might be interested in
What type of molecules move by osmosis?
kozerog [31]

Answer:

Osmosis is the diffusion of water molecules, from a region of higher concentration to a region of lower concentration, through a partially permeable membrane. A dilute solution contains a high concentration of water molecules, while a concentrated solution contains a low concentration of water molecules.

Explanation:

6 0
3 years ago
What identity status has an individual adopted who has neither experienced an identity crisis nor commitment?
PolarNik [594]

Answer:

Identity Diffusion

Explanation:

A person whose identity status is Diffusion has not had an identity crisis and has not yet fully realized their social identity or personal traits. Moreover, this person is not seeking to make a commitment to establish his or her identity. It is almost like identity Foreclosure; however, in that stage, the person adopts some traits and qualities of friends and parents.

7 0
2 years ago
What happens to air pressure as altitude decreases?
Makovka662 [10]

Answer:

B. air pressure increases

Explanation:

Think of it like this, the lower you are, the more air is above you. The higher ur elevation, the less air above you. I hope this can help!

6 0
3 years ago
Read 2 more answers
HELP WITH THIS!!! 10 points!!
finlep [7]

Answer:

it is radiant and chemical

Explanation:

it the process in which it converts light energy known as radiant to chemical energy. Takes energy from the sun.

4 0
2 years ago
Read 2 more answers
A (n) _______________ is an injection of weakened or dead viruses or bacteria, or pieces of proteins from weakened or dead virus
Law Incorporation [45]
<span>vaccine The wording given is pretty much the exact definition of a vaccine. The key to how a vaccine works is that it provides to the immune system, samples of the surface proteins of the infectious materials. With those samples available, the immune system is able to produce antibodies that react to those proteins.</span>
5 0
3 years ago
Other questions:
  • Which trait would best indicate that a particular arthropod was a member of subphylum chelicerata?
    13·1 answer
  • Most microscopes are parfocal. This means that the distance from the nose piece opening to the focal plane of each lens has been
    11·1 answer
  • What happens to the mass of bread when it is left for 5 days and it goes hard? Explain.
    15·2 answers
  • What makes get be a major difference between cells that are found in human cells and human nerve cells?
    15·1 answer
  • You have been assigned a DNA stretch. What is the complementary strand when you replicate the template
    12·1 answer
  • In word is the genus and which is the species of this scientific
    12·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • What is a long term change that happens after a flood?
    13·1 answer
  • HELPPPP please - biology
    14·2 answers
  • Mistakes can happen during DNA replication, and if they are not repaired it can result in a mutation. Certain mutations can lead
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!