You water three sunflower plants with salt water. Each plant receives a different concentration of salt solutions. A fourth plant receives pure water. After a two-week period, the height is measured. i think the indepent variable is sunflower ... variable is height measured and the control variable is the fourth plant.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Because most cigar and pipe smokers do not<u> </u><u>inhale the smoke</u> , as a group they have a lower risk of cancer than cigarette smokers.
The cigarettes, cigars, and pipe tobacco are made out of dried tobacco leaves. The other substances are usually added for flavor and to make smoking more gratifying. The smoke from these products is a complex mixture of chemicals produced by flaring tobacco and its additives.
There are at least 70 known chemicals to cause cancer. These cancer-causing chemicals are referred to as carcinogens.
It is so because cigars and pipes are usually believed to be less harmful way than to smoke tobacco. It was once a trend to use cigars in the 1990s, luring/dragging the young and the old.
Most of the people think cigars are less harmful to their health, but they actually pose the same risk for oral cancer as cigarettes do. Many cigar smokers don't inhale the smoke, but still the risk for oral, throat, and esophageal cancer is alike as for cigarette smokers.
To learn more about carcinogens here
brainly.com/question/984334
#SPJ4
Yes the o horizon layer is where most plant life is like in a forest it where all the roots of grass is
<span>Prokaryotic cells and eukaryotic cells reproduce by mitotic cell division. Regardless of the type of cell, all cells must make a copy of their dna before they divide.</span>
