<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
Answer:
I would write "terrestrial/lives on land during all life stages" between the frog and pigeon branches.
Explanation:
Jaw evolution has started with fish, so i'd place that before the perch, evolution of four limbs is next and I would plate it between the perch and the frog. Evolution of an egg has ensured that organisms remain terrestrial during all stages of life and don't need to rely on water to lay their eggs. So I would place that between the frog and the pigeon. True mammary glands and true hair, as we know it formed on mammals so i'd place that between the pigeon and the rats (although synapsids evolved similar structures long before birds even existed). And lastly, I would place "walking on two legs" between rats and human branches. Because our ancestors evolved bipedalism relatively late.
Answer: Option A) This is an anabolic process.
Explanation:
An anabolic process is simply a constructive process in which complex molecules are synthesized from simpler ones.
Thus just as photosynthesis or glycogen synthesis that yields complex molecules, since DNA replication leads to the synthesis of long double-stranded polynucleotides wounded together from a single strand (as in semi-conservative replication); we can therefore conclude that it is a anabolic process.
Answer:
Dietary fats are essential to give your body energy and to support cell growth. They also help protect your organs and help keep your body warm. Fats help your body absorb some nutrients and produce important hormones, too. Your body definitely needs fat.
Explanation:
