1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elis [28]
3 years ago
10

Explain why the majority of genes in an organism occur in pairs.

Biology
1 answer:
KonstantinChe [14]3 years ago
5 0

Answer:

Most living organisms keep their genes in their DNA. When alterations occur on the DNA or alterations are met during the formation of DNA strands, it is common that diseases close or related to the structure of genes is why.

You might be interested in
TEST Yourself
Nitella [24]

Answer:

Advanced,

Decomposers, producers, consumers

Skin

Explanation:

Decomposers are primary energy source by decomposing matter, this energy is released to the soil for plants absorb it to manufacture their food through photosynthesis and these food are consumed by man who gains energy in the process.

Higher layers should have more complex features than lower layers.

4 0
3 years ago
What will eventually happen as the earth's core cools down over billion of year?
Olenka [21]
The planet would growl and die . Also our magnetic shield would be gone and that would allow for cosmic radiation to hit the earth
8 0
3 years ago
In eukaryotes, photosynthesis takes place inside the
TEA [102]

Inside the chloroplast (a membrane-bound organelle present in plant cells)

5 0
3 years ago
True Or False urgebt
Fantom [35]

Answer:

The answer is true

Explanation:

true

7 0
3 years ago
Jonas Salk was awarded the Nobel Prize for discovering a way to vaccinate against
Bogdan [553]

Answer:

Jonas Salk was awarded the Nobel Prize for discovering a way to vaccinate against  polio in the United States in the 1950's. This allowed millions of school-age children to  avoid crippling disease, and to swim during summer again, as polio was often spread in public swimming areas before.

The statement that best describes how the polio vaccine works is:

It triggers the immune system to produce antobodies to fight the disease-causing agent.

Explanation:

There are two main reasons for this answer. The first one is that every vaccine is aimed to introduce a controlled amount of antigenes to be accepted by the organism. These antigens are made after some studies were conducted in a lab and were obtained from substances that the human body can accept to train the immune system to develop an effective defense for the virus or bacteria on the matter. In our case, the polio vaccine works the same way and allowed to save many lives.

3 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Cellular respiration occurs in: select one:
    13·1 answer
  • Which of the following would most likely not cause a genetic change
    13·1 answer
  • Many living things depend on the ocean currents for food, transportation, and a suitable climate.
    6·2 answers
  • Which type of space probe is designed to move around in the surface of a moon or planet
    15·1 answer
  • HURRY NEED ASAP!
    12·2 answers
  • Many scientists and drug companies have worked hard to produce drugs to stop various stages of the HIV life cycle. Some drugs ha
    9·2 answers
  • Which situation is an example of competition that could be found in the ocean?
    14·1 answer
  • Question is in the picture!
    7·1 answer
  • Can someone answer this question please
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!