1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nekit [7.7K]
3 years ago
6

What type of reproduction is most likely taking place?

Biology
1 answer:
Sauron [17]3 years ago
8 0

Answer:

Asexual reproduction.

Explanation:

Bacteria reproduce by asexual reproduction, in other words, they just make a clone of themselves. Because your graph is dealing with the growth of a bacterial population, I'm pretty sure that the type of reproduction happening here is asexual.

I hope this helps! Have a great day and give me Brainliest please!

Cheers!

You might be interested in
A man is exposed to large amounts of ultra Violet radiation while sunbathing at the beach. This exposure causes a genetic change
Mashcka [7]
His skin cells, only
7 0
3 years ago
The Punnett Square shows a cross between a mouse with black fur whose genetic makeup was BB, and a mouse with white fur whose ge
NNADVOKAT [17]

Answer:

There must have two white genes to become white.

Explanation:

In order to a mouse to have white fur, both of their genes must be white. In the punnet square, you have a Black (BB) and a white (bb). If they have offspring, all of them have one black (Dominant) and one white (recessive). The black gene overpowers the white gene, so they come out black.

7 0
3 years ago
Read 2 more answers
Select the part whose main job is to direct a plant cell's activities by sending instructions to different parts of the cell.
Gelneren [198K]

Answer: The nucleus

Explanation: It directs the cell's activities in the plant and animal cells.

7 0
3 years ago
Select the correct answer. A __ is an agent that causes disease. All ___ are pathogens.
Semmy [17]

1) pathogen

2) viruses


Some bacteria are not harmful to your body hence not all of them are pathogens


7 0
3 years ago
At the salinity of average seawater, what happens to density as the temperature increases? Is this also true of fresh water? Bra
ivanzaharov [21]

Answer:

The density of water increases as the salinity increases. The density of seawater (salinity greater than 24.7) increases as temperature decreases at all temperatures above the freezing point. The density of seawater is increased by increasing pressure.

Explanation:

5 0
2 years ago
Other questions:
  • Accusing people of dwe (driving while elderly) is considered a type of
    6·1 answer
  • Once a peptide has been formed between the amino acid attached to the tRNA in the P site and the amino acid associated with the
    13·2 answers
  • Why might polar bears become extinct
    6·2 answers
  • Which of the following is connective tissue?
    5·1 answer
  • Help i need it 10 PONTS I HAD 30 NOW I HAVE 20 :( do you wont more? ponts lol
    15·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Why is it important to be able to date fossils?
    12·2 answers
  • Why do daughter cells have DNA that is identical to the parent cell? Explain your answer.
    15·1 answer
  • Temperature affect the rate of how enzymes work in a chemical reaction <br> A. True <br> B. False
    12·1 answer
  • What do plant, animal and bacteria cells have in common?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!