1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alisiya [41]
4 years ago
13

Someone help pleasee

Biology
2 answers:
vaieri [72.5K]4 years ago
5 0

Answer: The 3rd one, answer C

valentina_108 [34]4 years ago
3 0

Answer: its c

Explanation: bc ik im right

You might be interested in
How does the food chain work
Karolina [17]
The food chain works like, us humans are at the top we eat everything below and because we are at the to of the food chain nothing eats us and everything below gets eaten. OK think about it like this the small fish eats the plankton and the medium fish eats the small fish and so on the big fish eats the medium fish and then the human or shark eats the big fish
7 0
3 years ago
Small organelle in the nucleus that makes ribosomes.
katrin [286]

Answer:The Nucleolus

6 0
3 years ago
Mutation is an evolutionary mechanism.<br> a. True<br> b. False
Dennis_Churaev [7]
Of course-true- without variation evolution would not existd
3 0
4 years ago
The image shows a mountain peak in asia which force most likely created this mountain ​
JulsSmile [24]

Answer:

A) erosion

Explanation:

5 0
3 years ago
Read 2 more answers
How could an endocrine system disorder most likely affect the respiratory system? A. It could restrict air flow through the bron
stepan [7]
I agree with B because the other ones are not impacted by hormones. Out of those choices the only factor impacted by hormones is B
8 0
3 years ago
Other questions:
  • Name 3 Ocean Biomes That Are Located In The Aphotic Zone.
    12·1 answer
  • In order to make progesterone molecule you need to start with what?
    11·1 answer
  • Why does the optic nerve cause a blind spot?
    15·1 answer
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • Which ingredient would a company that makes super-sour candy most likely use in large quantities?
    7·2 answers
  • What happens when a bond is formed in a macromolecule?
    8·1 answer
  • Have you ever noticed what happens to ice cubes if you leave them out? The ice changes into a liquid. Or maybe you've noticed wh
    7·2 answers
  • Cells go through different phases during mitosis before becoming what part of the parent
    14·1 answer
  • Come all girls to see my d***<br><br> xii-mzsd-qek​
    11·1 answer
  • Look at the picture<br>​
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!