1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
eduard
4 years ago
9

Receptors for hearing are located in the _______.

Biology
1 answer:
Inga [223]4 years ago
6 0
Cochlea.

The part of the ear where sound wave compressions and rarefactions cause the eardrum to vibrate is the middle ear. The 8th nerve in the inner ear actually converts the mechanical energy to electrical energy for transmitting to the brain. A membrane called the tympanic membrane separates the middle ear from the outer ear. Whenever a sound reaches the ear, it creates a sound wave that creates vibration in the eardrum. The pressure when high pushes the membrane inwards while low pressure sound waves helps the eardrum to come outwards.  <span>

These sound waves are then transduced when it reaches the cochlea where hair-like structures interprets the sensory information and is relayed to the brain.</span>

You might be interested in
A father has AB blood and his wife has type O blood. What are the possible blood type percentage of their children.​
Crazy boy [7]

Answer:

hey

Explanation:

5 0
3 years ago
State the parts of skeletal muscles. Describe their relationship to each other. Use the terms actin, myofibrils, myosin, and sar
8_murik_8 [283]

Answer:

why does it even say that

Explanation:

what does it even say

3 0
2 years ago
Which of the following would result in an increase in blood flow?
AysviL [449]
The answer would be option C
8 0
3 years ago
Read 2 more answers
This is responsible for providing shape to the cell​
sasho [114]
The cytoskeleton of a cell forms its shape.
6 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Other questions:
  • In Passage 1, how does the author represent the various points of view on the issue of advertisements on school buses?
    10·2 answers
  • The lifetime prevalence for having a disorder of any type is approximately:
    12·1 answer
  • Read the list of substances. Air, Copper, Glass, Gold, Wood Which substances have high electrical conductivity?
    13·2 answers
  • The word medium is used in paragraph 4. Which of the following could be the definition of medium?
    9·1 answer
  • Як навчитися грати на укулеле<br>​
    15·1 answer
  • 1. How many protons and neutrons are in nitrogen atoms (714N)?
    11·2 answers
  • 2. Match the following:
    8·1 answer
  • Which of the following is the entire life of a cell?
    7·2 answers
  • What fraction is a punnett square with SS Ss Ss ss
    6·1 answer
  • What would happen if the operator sequence of the trp operon contained a mutation that prevented the repressor protein from bind
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!