Ice should be applied within the first 5-10 minutes after getting the injury and leave the ice for
20-30 minutes. This can be repeated every 2-3 hours or so for the next 24-48 hours.
If you consider the first 48 hours, and this timings, the frequency should be between 16 to 24 times. If you consider 24 hours, it should be between 8 and 12 times.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
I believe the answer to this would be A. True
Oxidative phosphorylation requires a proton gradient.
- Cells use enzymes to oxidize foods in the metabolic pathway known as oxidative phosphorylation, electron transport-linked phosphorylation, or terminal oxidation, which releases chemical energy to create adenosine triphosphate.
- This happens inside mitochondria in eukaryotes. The majority of the energy required for biosynthesis, maintaining a healthy ion balance, and mechanical effort is provided by oxidative phosphorylation, which is the principal source of ATP in higher animals.
- A succession of proteins and electron carriers in the mitochondrial membrane, as well as the electron transport chain, are all involved in the process of oxidative phosphorylation.
learn more about Oxidative phosphorylation here: brainly.com/question/13254827
#SPJ4
Alright bud the best answer to this question would be that the stratum basale or stratum germinativum which would be the bottom most part of the epidermis has the highest mitotic rate