1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Advocard [28]
3 years ago
14

Long-term use of __________ can lead to permanent hearing loss, limb spasms, nervous system and brain damage, and bone marrow da

mage. help
Biology
1 answer:
Bess [88]3 years ago
6 0
Antihistamine

This is a medication that can be bough without prescription. These is primariy used in allergies such as runny nse, watery eyes and itching. This can also give side effects such as drowsiness, dizziness and confusion. This can also affect on how the body process chemicals making them especially risky in combination with other drugs. This can have interactions with other drug that even a non lethal dose can cause life threatening condition.
You might be interested in
HELp I will give brainliest thanks
cluponka [151]
Guessing it’s D. Hope this was helpful!
8 0
3 years ago
What characteristic do all deserts share?
olasank [31]
It is dry. A desert has low moisture because of low rainfall, high evaporation, or extreme cold. Also sand and ice, desert landscapes can be mad up of gravel, sandy soil, and outcroppings of bare rock.
5 0
4 years ago
Smooth pods are dominant over constricted pods. If one parent has constricted pods and the other parent is homozygous for smooth
Oxana [17]

If we name the gene for pods with A, than the alleles are: A-dominant, a-recessive.

The possible genotypes for the smooth pods are: Aa and AA, while genotype for constricted pods is aa.

If one parent has constricted pods and the other parent is homozygous for smooth pods there are two possible combinations:

P: AA  x  aa

F1: Aa Aa Aa Aa all of the offspring are constricted

Another combination:

P: Aa  x  aa

F1: Aa Aa aa aa half of the offspring are with constricted pods and half with smooth pods.

So, the correct answers are:

•       all of the offspring will have constricted pods  

• 50% of the offspring will have constricted pods and 50% will have smooth pods.

6 0
3 years ago
Where is energy trapped inside the organelle chlorophyll
Alexxandr [17]

the green light absorbing pigment in the chloroplast traps energy

6 0
3 years ago
(20 points!) { BRAINLIEST} PLS HELP <3
daser333 [38]

Answer:

D. chromosomes

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • when fracking liquid is left on the pools on the surface,____ can evaporate into the air and contribute to pollution.
    12·1 answer
  • _________ cells produce granules that secrete a lipid-rich product that help make the skin waterproof
    15·1 answer
  • What is the second longest stage of The cell cycle
    7·2 answers
  • An organelle that takes in sunlight energy, carbon dioxide, and water to make food for plants
    13·2 answers
  • Cortisol, epinephrine, and norepinephrine are also known as stress hormones. true or false
    13·2 answers
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • Help Brainliest to anyone who answers me ASAP!!!
    9·1 answer
  • Can anyone help me get caught up this is only on of the 12 assignments i need help on
    10·2 answers
  • Which statements about electromagnetic waves are true?
    14·2 answers
  • List the producers in a food web
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!