1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
shusha [124]
3 years ago
8

When a scientist is conducting research about all the plants and wildlife in the Mojave Desert as well as the desert’s resources

, such as water and soil, the scientist is studying
Biology
2 answers:
iVinArrow [24]3 years ago
6 0

Answer:

The answer is D, ecosystem.

Explanation:

I took the test ;)

daser333 [38]3 years ago
4 0
Biologists and a <span>botanist</span>
You might be interested in
Respiration involves the breakdown of sugar. This process results in the production of energy for the cell. Assess the model to
Nastasia [14]

This is the process called cellular respiration,it requires sunlight, glucose and A)Oxygen.

6 0
3 years ago
Read 2 more answers
Carla has applied for a loan. Choose from the following conditions the one that makes it likely that she will get an unsecured l
Vedmedyk [2.9K]
I think the correct answer from the choices listed above is option B. The condition that  makes it likely that she will get an unsecured loan is that <span> she is ready to pay a huge amount in interest. </span><span> An unsecured loan is a type of loan where there is no property that can be used as collateral and something that will prove she is worthy of the loan.</span>
6 0
3 years ago
Read 2 more answers
А
PIT_PIT [208]
Transport protein cytoskeleton microtubule
6 0
2 years ago
An end to that species' existence is known as
daser333 [38]
This is known as extinction
3 0
3 years ago
What is the difference between a vascular and a nonvascular plant? In your answer, discuss how water moves in each type of plant
dexar [7]

Both plants have separate tubular tissues like Xylem and Phloem to transport food, minerals, and water, right? Those are called the vascular plants. So for those that don't show this kind of differentiation of the tissue, they're called the non-vascular plants.

Water and the other nutrients just move through the plants' body, cell by cell. The plants can get water this way but only if the plants' body is no more than a few cells thick.

3 0
3 years ago
Other questions:
  • If two protons are removed from an oxygen nucleus, the result is
    11·1 answer
  • What is plant cells made of
    5·2 answers
  • Which type of drug has never played a role in health care? opiates depressants inhalants stimulants?
    5·1 answer
  • You probably believe that Earth is spherical. But as we look around, it certainly appears that earth is flat. One classmate sugg
    10·1 answer
  • Search the Internet for ongoing research projects about food safety and sanitation. Consult governmental or education sites for
    9·1 answer
  • Answers in picture PLZZZ HELP
    14·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • In which phase of mitosis does the nuclear envelope disappear, chromosomes become visible, and centrioles begin to form mitotic
    9·1 answer
  • List and describe 4 features of the ocean floor
    5·1 answer
  • HELP I NEED HELP ASAP
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!