1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
valentinak56 [21]
3 years ago
10

How are ionic and covalent bonds different from hydrogen bonds ?

Biology
2 answers:
loris [4]3 years ago
8 0
Hello.

They are different because ionic and covalent bonds are closer then hydrogen bonds. And ionic and covalent bonds have a i<span>ntramolecular </span>bond becasue that is were the force excist. 
Ionic bond<span> strengths range from 600 kJ/mol to 6000 kJ/mol.
 </span>Covalent bonds<span> form when two atoms share electrons.

Have a nice day</span>
yuradex [85]3 years ago
3 0
I believe this is your answer hope this helped

You might be interested in
Can anyone help me with this question??<br> Help!!
andrey2020 [161]
1990. Do not let the partial collapse during 1980s confuse you.
3 0
3 years ago
The ileum contains ________ that project into the lumen and increase the amount of surface area.
Ivanshal [37]

The ileum contains villi that project into the lumen and increase the amount of surface area.

Villi are small finger-like structures that project into the lumen of the small intestine. Villi increase the surface area of the intestinal walls for easy and quick absorption of digested food with the addition of digestive secretions. Villi vary in length from about 0.5 to 1 mm. They are usually found in large numbers at the beginning of the small intestine and they reduce toward the end of the tract.


5 0
3 years ago
Read 2 more answers
In coccidioidomycosis, _______ containing many endospores form in the lungs.
dolphi86 [110]

Answer:

spherules

Explanation:

Like histoplasmosis, coccidioidomycosis is acquired by the inhaling fungal spores.

<u>Arthrospores are formed by the hyphal fragmentation in this case. Once in body, fungus differentiates into the spherules which are filled with the endospores. </u>

Most of the C. immitis infections are self-limiting and asymptomati. The endospores are transported in blood, disseminating infection and thus leading to formation of granulomatous lesions on face and nose. I

<u>Thus, spherule is a thick-walled spherical structure which encloses the endospores and occurring in parasitic form of the fungi of genus Coccidioides.</u>

7 0
3 years ago
What would happen if our lungs where made up of only one big alveoli?
Dimas [21]

The process of respiration system would not function well if the lungs was made up of only one big alveoli.

<u>Explanation:</u>

The main role of alveoli is to help the lungs to breath, for ventilation, diffusion and perfusion. The process of respiration system would not function well if the lungs was made up of only one big alveoli.

Alveoli are tiny to help the flow of oxygen and carbon dioxide, it helps the oxygen flow into the lungs and remove the carbon dioxide. If the alveoli is just one and big, then it would be hard to flow the oxygen through lungs and remove the carbon dioxide.

Therefore, it is good to have many tiny alveoli than one big one or the rib cage  that protect the lungs could go through some damages.

7 0
3 years ago
I NEED HELP WITH ALL QUESTOONS PLEASE
Ulleksa [173]

Answer:

3) B

4) A

5) B

Explanation:

3) Sun heats up the air of a particular region due to which the air heated rises up ( as hot air is lighter than cool air ). When the hot sir rises , the cool air from other region comes there & like this wind blow.

4) A toaster uses electricity to produce heat in order to toast bread  So here the electric energy is converted to thermal energy.

5) Windmills , Hydroelectricity dams & Ethanol plants have turbines & turbines do have a generator which is to be rotated . When the generator is rotated , electricity is generated.

3 0
3 years ago
Other questions:
  • "which pathogens consist of bits of nucleic acid within a protein coat?"
    12·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • The nitrogen cycle is most directly dependent upon-
    8·1 answer
  • What charetieistic is used to classsify a mammal as monotremes marispuial or placental mamel
    15·2 answers
  • What types of genes also have more than two phenotypes?
    13·1 answer
  • Which choice describes most of the rocks exposed to the Earth's surface?
    14·1 answer
  • Please help pleasseeeee will give anything I really need help please a lot of points
    6·1 answer
  • Describe the difference between codominance and incomplete dominance. Give 1 example of each.
    15·1 answer
  • How do DNA and mRNA vaccines produce spike proteins ? Drag each item into the correct category.
    11·1 answer
  • to is when a stimulus successfully stimulates an action potential in its specific neuron. how your brain interprets the message
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!