16. The method of movement that requires the expenditure of ATP molecules is

Biology

1 answer:

stira [4]3 years ago

3 0

Answer:

It is active transport

Explanation:

because the ions are moving against the concentration gradient

You might be interested in

Given the DNA sequence -- 5’ CTCTCCCCCGCGGGGGCTGTACTATCATGCGTCGTCTCGGUUAAUUU 3’ determine the mRNA sequence. (N.B. Answer must i

Marat540 [252]

During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.

In this case, the complementary mRNA sequence is:

3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´

Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.

Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.

According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.

In RNA, Thymine (T) bases are replaced by Uracil (U).

Learn more in:

brainly.com/question/837295?referrer=searchResults

7 0

3 years ago

Franz Boas believed that cultures develop in different ways because of the unique and complex sets of issues and situations that

Lina20 [59]

Answer:

The correct answer is - option D. historical particularism.

Explanation:

Historical particularism is the very commonly accepted case of the school of thought related to the comparative study of the cultures. It has declined other evolutionary model of that time.

According to this model, there is some universal law for the development or cultural evolution. It mean if the societies or cultures are able to develop to the various paths to same level of cultural development.

Thus, the correct answer is - option D. historical particularism.

6 0

3 years ago

Question 1 (3 points)

PSYCHO15rus [73]

Answer:

all living things have heredity to pass their traits to offspring

Explanation:

wrong for example a tiger mates with a lion making a cross breed that cross breed is unable to pass on it's genetic code to another liger

7 0

3 years ago

Even when asymptomatic, _______ can still be actively multiplying and killing cells in the immune system that help fight pathoge

podryga [215]

Even when asymptomatic, the virus can still be actively multiplying and killing cells in the immune system that help fight pathogens. This is further explained below.

<h3>What is a virus?</h3>

Generally, the virus is simply defined as a virus consisting of a core of genetic information, either DNA or RNA, wrapped by a capsid, which is a protective covering formed of protein.

In conclusion, It is possible for the virus to be actively reproducing and destroying immune cells even in the absence of any outward symptoms.