1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nikklg [1K]
3 years ago
11

16. The method of movement that requires the expenditure of ATP molecules is

Biology
1 answer:
stira [4]3 years ago
3 0

Answer:

It is active transport

Explanation:

because the ions are moving against the concentration gradient

You might be interested in
Given the DNA sequence -- 5’ CTCTCCCCCGCGGGGGCTGTACTATCATGCGTCGTCTCGGUUAAUUU 3’ determine the mRNA sequence. (N.B. Answer must i
Marat540 [252]

During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.

In this case, the complementary mRNA sequence is:

  • 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´

  • Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.

  • Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.

  • According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.

  • In RNA, Thymine (T) bases are replaced by Uracil (U).

Learn more in:

brainly.com/question/837295?referrer=searchResults

7 0
3 years ago
Franz Boas believed that cultures develop in different ways because of the unique and complex sets of issues and situations that
Lina20 [59]

Answer:

The correct answer is - option D. historical particularism.

Explanation:

Historical particularism is the very commonly accepted case of the school of thought related to the comparative study of the cultures. It has declined other evolutionary model of that time.

According to this model, there is some universal law for the development or cultural evolution. It mean if the societies or cultures are able to develop to the various paths to same level of cultural development.

Thus, the correct answer is - option D. historical particularism.

6 0
4 years ago
Question 1 (3 points)
PSYCHO15rus [73]

Answer:

all living things have heredity to pass their traits to offspring

Explanation:

wrong for example a tiger mates with a lion making a cross breed that cross breed is unable to pass on it's genetic code to another liger

7 0
3 years ago
Even when asymptomatic, _______ can still be actively multiplying and killing cells in the immune system that help fight pathoge
podryga [215]

Even when asymptomatic, the virus can still be actively multiplying and killing cells in the immune system that help fight pathogens. This is further explained below.

<h3>What is a virus?</h3>

Generally, the virus is simply defined as a virus consisting of a core of genetic information, either DNA or RNA, wrapped by a capsid, which is a protective covering formed of protein.

In conclusion,  It is possible for the virus to be actively reproducing and destroying immune cells even in the absence of any outward symptoms.

Read more about the virus

brainly.com/question/25859411

#SPJ1

3 0
2 years ago
What is another word for the spine?
morpeh [17]
I have only heard a few phrases for spine


Backbone
Vertebrae (vertebral column)
Spinal column
6 0
3 years ago
Read 2 more answers
Other questions:
  • Which of these is rich in unsaturated fats mastering biology?
    6·1 answer
  • What do scientists now think about the basis of life
    11·1 answer
  • How many cells are there in the human body?
    9·2 answers
  • Choose the best answer that describes what is happening during the process of interphase.
    7·1 answer
  • Can I please get help with this question
    12·2 answers
  • This Pedigree represents a family with an Autosomal Recessive Disorder. What is the probability that IV4 and IV5 have a child wi
    15·1 answer
  • Which of the following parts of the plant facilitates photosynthesis?
    12·2 answers
  • What did the plastic wrap represent in this model?
    12·1 answer
  • A liver cell has a volume of 5000 μm3. Its total membrane area, including the inner membranes lining organelles as well as the c
    7·1 answer
  • What happens to mRNA after transcription ?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!