1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vikki [24]
3 years ago
12

Which of the following statements about wildfires is true?

Biology
1 answer:
ValentinkaMS [17]3 years ago
8 0
The true statements about wildfires is that they can spread all over the forests

You might be interested in
HELP <br><br> Why is sea temperature important?
Snezhnost [94]

Explanation:

Sea surface temperature provides fundamental information on the global climate system. ... SST is an essential parameter in weather prediction and atmospheric model simulations, and is also important for the study of marine ecosystems. SST data are especially useful for identifying the onset of El Niño and La Niña cycles

8 0
2 years ago
Read 2 more answers
You have just delivered a premature baby. Your assessment reveals that he is breathing adequately; however, his heart rate is 90
s2008m [1.1K]

Answer:

The answer is letter B, keep him warm and ventilate with BVM.

Explanation:

In order to know more about the answer, let's check out the meaning of "Premature Baby" first.

Premature Baby- a baby born through premature birth <em>(fewer than 37 weeks).</em>  Babies are normally born at the usual <em>40 weeks.</em> Health problems may occur with premature babies, thus it is very important to monitor them.  

In the situation above, the premature baby's heart rate is only 90 beats/min. <em>A resting heart rate for a newborn infant is 130-150 beats per minute. </em>This means that the baby above has a slow heart rate. In order to increase the hear rate, it is important to keep the baby warm and to ventilate with a "Bag Valve Mask" (BVM). <u><em>An increase in internal temperature increases the heart rate. Increasing ventilation will also help increase the heart rate. </em></u>

<u><em>Remember: </em></u>Inhalation increases the heart rate.

4 0
3 years ago
What type of sound is particularly effective for many marine mammals because it allows sound to travel for very long distances i
kifflom [539]
They produce narrow-band high-frequency sound to help them navigate in water. These high-frequency sounds are used in echolocation.  Echolocation is used to identify and locate prey and also avoid the predators. Marine mammals like whales and dolphin use echolocation in different manners.
3 0
3 years ago
The condensation of _____ formed the early oceans. It is an important part of the water cycle. meteorites water vapor living org
Alex787 [66]
The condensation of water vapor formed the early oceans. It is an important part of the water cycle. It is easy to eliminate the other answers in this question. It can't be meteorites, living organisms, or nitrogen.
7 0
3 years ago
Read 2 more answers
_______ research has the potential to significantly impact the development of disease-modifying treatments for Parkinson's disea
nydimaria [60]

<u>Stem cell </u>research has the potential to significantly impact the development of disease-modifying treatments for Parkinson’s disease with considerable progress made in creating dopamine-progressing cells.

Explanation:

Parkinson’s disease, a neurodegenerative disease, leads to reduction of dopamine (a neurochemical messenger which carries messages involving thinking and body movements to brain) in the body because the disease will target and kill dopamine-producing nerve cells (neurons). This leads to loss of movement and thinking abilities which are activated by dopamine.

Stem cells research is done to study about the prospects of stem cells in stem cell therapy for Parkinson’s patients as a viable source of new dopamine nerve cells. Research has been involved in growing stem cells to replace or regenerate dopamine-producing nerve cells by using embryonic stem cells or induced pluripotent stem cells as a treatment modality in Parkinson’s disease.

5 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following processes is used to bake breads?
    8·1 answer
  • Not all members of a species are the same. Every species exhibits__. __, like eye color, are passed from parent to offspring.
    13·2 answers
  • Suppose two species live in close contact with each other. one species benefits by eating the tissues of the other, and the othe
    11·2 answers
  • What organisms can make their own food from sunlight
    13·2 answers
  • Which type of molecule makes up the double layer of a cell membrane?
    8·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Which of the following can affect the function of the cell? A. High temperature B. High acidity C. Low temperature D. All of the
    15·1 answer
  • Many scientists are worried that the increased amount of carbon dioxide in Earth's atmosphere will _____
    6·1 answer
  • Which BEST describes how the removal of the trees and plants will affect the level
    15·1 answer
  • Exposure to _________ would most likely result in immediate respiratory distress.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!