1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andreas93 [3]
3 years ago
5

Why do lipophilic hormones require carrier proteins while being transported in the blood?

Biology
1 answer:
valina [46]3 years ago
6 0

Lipophilic hormones, intuitive as the name suggests, tend to dissolve well in lipids/fats than they do in water. Therefore lipophilic hormone does not dissolve well in blood plasma which would affect their diffusion.  The carrier proteins are mainly the serum albumins.


You might be interested in
the graph demonstrates the quantitative variation for skin pigmentation. which conclusion is supported by the graph? a)more than
BartSMP [9]

Answer : Option D) Fewer people have skin pigmentation lighter than the central peak than people who have pigmentation darker than the central peak.

Explanation : The quantitative variation which is shown for the skin is best explained by option D. Which shows that fewer people have got skin pigmentation which is lighter than the central peak in the graph, compared to the people who have darker pigmentation than the central peak.

4 0
3 years ago
Read 2 more answers
When a flowers pollen meets its seed it's called a what???<br><br> I need a word
Snezhnost [94]
Germination I think that it’s
5 0
3 years ago
Select the part of the ATP molecule that stores and releases energy.
julia-pushkina [17]
B. the last phosphate group has a lot of energy stored in the bond that connects it to the other two phosphates.
3 0
3 years ago
Read 2 more answers
The positively charged particle in an atom is the
Nadusha1986 [10]

Basic charged atomic particles are electrons (negatively charged) and protons (positively charged). It is a particle on an atomic scale that is charged

4 0
3 years ago
What did researchers working on the human genome project accomplish? multiple choice they estimated how many genes humans have.
vazorg [7]
<span>The purpose of the Human genome Project was to find the nucleotide sequence of the human genome and to also map the locations of where they are on the chromosomes. They accomplished finding how gene expressions is controlled as well as predicting disorders and now they have also developed gene therapy.</span>
7 0
3 years ago
Other questions:
  • The History of voting in American is the history of the expansion of which of the following?
    15·1 answer
  • 1)The picture is an aerial view of what and what type boundary forms this feature?
    11·1 answer
  • If 10 cubic centimeters of a liquid has a mass of 70 grams what is its density
    15·2 answers
  • Quick is de word...<br>taking yuh less than a min...<br>​
    10·1 answer
  • Which of the following could be a method used to estimate the age of an ancient rock? To find out its mineral composition To fin
    5·2 answers
  • 1: Describe the events of the muscle stimulation and contraction starting with the influx of Ca at the synaptic knob (of the neu
    5·1 answer
  • Which product is missing from the Kreb's cycle? Pyruvate + Oxygen → _________ + 2 ATP Group of answer choices ATP Oxygen Water C
    11·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Inorganik bilesikler metobolik faaliyetlerde duzenliyici olarak kullanlir mi​
    11·1 answer
  • In the nebular hypothesis, why did the nebula start to collapse?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!