1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mariulka [41]
3 years ago
7

Rhizobium bacteria are important in soil fertility because plants​

Biology
2 answers:
Naddika [18.5K]3 years ago
5 0

Rhizobium bacteria fix nitrogen after becoming established inside the root nodules of plants(such as legumes)

densk [106]3 years ago
4 0

Answer:

Rhizobia are soil bacteria that have the ability to do just that - convert nitrogen into ammonia. They multiply and form nodules attached to the plant roots of leguminous plants such as peas and beans. There are multiple species of rhizobia and not all can form nodules in all leguminous plants.

Hoped i helped lol

Explanation:

You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Which of the following happens when ice melts?
iren [92.7K]
B because when ice melts it doesn't stay  in the same form
7 0
3 years ago
A ______ is anything in the environment that affects the behavior of an organism.
Svetach [21]

Answer:

Heyaaa!!! Your answer for this question will be....

Explanation:

!!! <u><em>Stimulus aka (D)</em></u> !!!

<em>Lmk If You Have Any More Questions!</em>

<em />

<em>  </em><em>Have A Nice Day!!</em>

<u><em>~Pinky~</em></u>

7 0
3 years ago
Read 2 more answers
What type of cells are created in the cell cycle and mitosis?
rewona [7]

Answer:

Mitosis produces new cells, and replaces cells that are old, lost or damaged. In mitosis a cell divides to form two identical daughter cells.

Explanation:

i got my answer from go0gle _-_

7 0
3 years ago
Read 2 more answers
Enzymes speed up a biological reaction by?
Fittoniya [83]
D. Raising the activation energy
7 0
3 years ago
Read 2 more answers
Other questions:
  • A ridge of till located at the farthest point reached by a glacier is called a
    12·1 answer
  • Diffusion occurs because of the ________________________ of molecules.
    12·1 answer
  • Which of the following is a limit of science?
    10·1 answer
  • A gene which is expressed in a heterozygous individual is...
    11·1 answer
  • Biosphere II is a self-contained ecological system that was sealed with researchers inside. Unfortunately, the microbes in the s
    7·1 answer
  • Whats the basic unit of life?
    9·1 answer
  • I need help with this IMMEDIATELY I will give 20 points and give a brainliest answer if someone answers it. PLZ HELP ME NOW!!! W
    12·2 answers
  • Explain the structure of a mosquito briefly.​
    15·2 answers
  • Question 4(Multiple Choice Worth 4 points)
    6·2 answers
  • What can you conclude from the distribution of the red fluorescence.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!