1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
oee [108]
3 years ago
6

How long does it take for fertilized egg to attach to uterus?

Biology
1 answer:
geniusboy [140]3 years ago
4 0
3 to seven days prior to sexual intercourse.
You might be interested in
Help help help help me please!!!!!!!!!!!!!!!!
MatroZZZ [7]

The correct answer should be The ability to reproduce only within a species.

3 0
3 years ago
Read 2 more answers
What is not a step in most scientific investigations
Mariulka [41]

Question options:

1. developing a hypothesis to explain collected data

2. proving a theory and writing a new scientific law  

3. collecting data through observation and measurement

4. observing and experimenting to test a hypothesis

Answer:

2. proving a theory and writing a new scientific law  

Explanation:

Providing a theory and write a new scientific law is not a step of scientific investigation. To prove a law a theory, its take many years of research.

There are steps of scientific investigations below,

1. Make an Observation.

2. Form a Question.

3. Form a Hypothesis.

4. Conduct an Experiment.

5. Analyze the Data and

6. Draw a Conclusion.

These step of scientific investigation does not include to write a theory and scientific law.

4 0
3 years ago
An error in which macromolecule is the cause of hermophia
kiruha [24]
In hemophilia A it’s caused by a mutation in the gene for factor VIII. Hemophilia B is a result in a deficiency in factor IX due to a mutation in its corresponding gene.

In both cases, it is a mutation in the DNA (the macromolecule).
8 0
3 years ago
What is the major diffrenece between plant and animal cells​
RideAnS [48]

Answer:

Plant cells have cell walls while animal cell do not.

Explanation:

4 0
3 years ago
Read 2 more answers
Can something alive be only unicellular?why or why not?
Lynna [10]

Yes because the cell that the organism is made out of is its life source. For example, bacteria is a single celled organism.

6 0
2 years ago
Other questions:
  • True are false bacteria are the most abundant form of life on earth
    13·2 answers
  • Q1.Tissues working together to perform specialized functions are called-
    8·2 answers
  • Compare electron microscopes and optical microscopes.
    14·2 answers
  • PLEASE HELP!!!! WILL BE MARKED AS BRAINLIEST
    14·1 answer
  • Pancreatic hormones regulate blood glucose levels. identify two pancreatic hormones and describe the effect of each hormone on b
    10·1 answer
  • Golgi bodies are organelles that process and package macromolecules, such as proteins and lipids, for export out of the cell. Gi
    12·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • The study of living things and their environments is called
    5·2 answers
  • The cardiorespiratory system includes the following parts of the body
    6·1 answer
  • The nurse places the stethoscope on the 3rd intercostal space at the left sternal border. Which area is the nurse auscultating f
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!