1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksandrvk [35]
3 years ago
5

Which word identifies a large natural or human-made lake used to supply water?

Biology
2 answers:
zzz [600]3 years ago
7 0

Reservoir is the word that identifies a large natural or human-made lake used to supply water.

Reservoir is a large natural or human- made lake used as a source of water supply. Reservoirs are very useful because they supply water when natural water bodies such as rivers, run dry (especially during droughts). Reservoirs help to control flooding and they are also used for fishing and boating. Valley-dammed reservoirs, bank-side reservoirs, and service reservoirs are the three main types of reservoirs.


Volgvan3 years ago
5 0
Reservoir the answer is a reservoir
You might be interested in
How can a small area in the middle of the desert provide an organism what it needs to survive
pishuonlain [190]
Because the small area of that desert provides the provisions the organism needs. They adapt to their climate, so as long as the desert keeps its supply, the organism will stay
3 0
3 years ago
Read 2 more answers
The age of oceanic bedrock on either side of a mid-ocean ridge is supporting evidence that at the ridges, tectonic plates are __
ratelena [41]

The age of oceanic bedrock on either side of a mid-ocean ridge is supporting evidence that at the ridges, tectonic plates are Diverging .

Explanation:

The underwater mountain range is the mid oceanic ridge, which were formed as a result of plate tectonics.  when the convection current goes up in the mantle present beneath the oceanic crust results in the uplifting of the ocean floor.

Which leads to the formation of the tectonic plates through magma, that meet at divergent boundaries. The density and the age and the thickness of these oceanic crust increases due to the distance from the ridges. The mid oceanic ridges has been split on two sides as matching stripes ,

7 0
4 years ago
How might a business owner see the problem with Jaffrey Lake differently than an environmentalist?
madam [21]
A/The business owner might see a problem with Jaffrey Lake differently than an environmentalist because Jaffrey is a scam artist
5 0
3 years ago
What is located on chromosomes and carry hereditary instructions?
kondor19780726 [428]
Genes. Chromosomes carry genes that contain genetic information of the organism it is in.

Hope this helps :)
4 0
3 years ago
The U.S. government protects fish, a common resource, by A. heavily taxing competing industries. B. subsidizing the fishing indu
olasank [31]

Answer:

The U.S. government protects fish, a common resource, by selling fishing licenses and regulating fish lengths

Explanation:

When there is regulation about a particular goods, it reduces the rate the availability of such goods is abused, US government could actually protect fish through licensing and regulation of the type to be sold including there length which ensures the protection of the juvenile.

4 0
3 years ago
Other questions:
  • when the theory that the sun goes around the earth was replaced with the theory that earth goes around the sun, this was an exam
    15·2 answers
  • A(n) ___________ provides a translation of the project scope into specific activities.
    15·1 answer
  • Can air pressure be strong enough to crush an aluminum can?
    7·1 answer
  • Terms in order from smallest to largest: species, biosphere, cell
    9·2 answers
  • Can the energy, in an ecosystem, flow forwards and backwards?
    8·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • My doctor explained that Clomid works by "tricking the brain into thinking that estrogen levels in the body are low." She explai
    5·1 answer
  • This is a science question i have. Plz help
    6·1 answer
  • Las plantas y sus funciones
    6·1 answer
  • 6. Blood type is determined by three alleles, A, B, and O. Use the
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!