This means that the mothers green eyes are recessive alleles and the fathers brown eyes are dominant alleles. The blue eyed puppy is blue eyed because there must have been a gene in the mothers or fathers past generation.
<span>If
ever your small boat capsizes in the swift water, all you need to do is to float
on the upstream side of the craft and never try to walk in swift water nor
stand, and this will assure your safety. Also make your feet arms widely opened
or extended with your feet pointed to the downstream.</span>
Answer:
C.
Explanation:
In the context of evolutionary biology, coevolution refers to the evolution of at least two species, which occurs in a mutually dependent manner. ... An example is the coevolution of flowering plants and associated pollinators (e.g., bees, birds, and other insect species)
The principal function of thyroxine is to stimulate the consumption of oxygen and thus the metabolism of all cells and tissues.
Thyroxine is termed T4. It travels through the blood to the target cells and becomes converted to triiodothyronine or T3.
T3 is the active form of thyroxine. T3 enters the target cell's nucleus binding to genes responsible or involved in the metabolism of sugar in the body. T3 stimulates these genes and in so doing metabolism (conversion of oxygen and calories to energy) is carried out by the cell, which also results in generation of body heat.
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
